Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A Molecular Marker Primer Associated with Rapeseed Silique Number and Its Application

A technology of siliques and forward primers, applied in the fields of molecular biology and genetic breeding, can solve problems such as undiscovered, achieve the effects of reducing workload, speeding up the breeding process, and shortening the breeding cycle

Active Publication Date: 2020-04-28
INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no research report related to the number of siliques near the 19,267,907 base position on chromosome A03, which is a new locus controlling the number of siliques in rapeseed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A Molecular Marker Primer Associated with Rapeseed Silique Number and Its Application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Acquisition of SNP markers significantly associated with rapeseed silique number:

[0028] (1) Collect 331 inbred lines of Brassica napus from various countries in the world as the core related population of rapeseed, collect individual leaves of each line of the related population, extract the total DNA by CTAB method, and use the rapeseed 60K SNP chip to analyze each sample Perform genotype analysis.

[0029] (2) Use the Illumina BeadStudio genotyping software (http: / / www.illumina.com / ) to calculate the marker heterozygous rate (heterozygous rate), missing rate (missing rate) and minimum allele of the population material at each locus Gene frequency (minor allele frequency). The deletion rate ≤ 0.2, the heterozygosity rate ≤ 0.2, the minimum allele frequency > 0.05, and the unique match of the SNP marker in the Brassica napus genome were used as the screening criteria to filter the SNP markers, and finally 24,508 high-quality SNP markers were obtained for the whole g...

Embodiment 2

[0033] Acquisition of a molecular marker primer significantly associated with the number of siliques in rapeseed:

[0034](1) Extract the sequence of 100 bp upstream and downstream of the 19th, 267, 907th base on the rape A03 chromosome, and develop the SNP marker primer snpA03-1 according to the primer design principle, the forward primer is snpA03-1F: ATTTTCATTGATAAACATACCGAATT, and the reverse primer is snpA03-1R ::TCAATTCATGCTGAAAATTAATGACTAT, the amplicon size is 152bp.

[0035] The sequence amplified in Brassica napus material 73290 is the GG genotype, and the sequence is as follows:

[0036] TAAACATACCGAATTCCTTTTTTTGTTTTGTTGAAACATATTGATTATGTTGAAACATATTGATTACCTTACAACGATTCGAAATGGTTTTTTTCACCTCTACGTCGGGAATCCAAACGTTATAAATAGTCATTAATTTTCAGCATGAATTGA

[0037] The sequence amplified in Brassica napus 51070 is the AA genotype, and the sequence is as follows:

[0038] TAAACATACCGAATTCCTTTTTTTGTTTTGTTGAAACATATTGATTATGTTGAAACATATTGATTACCTTACAACGATTCGAAATGGTTTTTTTCACCTCTACATCGGGAAT...

Embodiment 3

[0042] The application of primers designed based on the 19,267,907th base on the rapeseed A03 chromosome in screening breeding for the number of rapeseed siliques, the steps are as follows:

[0043] (1) Select 20 multi-silique materials (over 70 siliques in the main inflorescence) and 20 low-silique materials (less than 45 siliques in the main inflorescence) among 331 associated populations.

[0044] (2) The distribution of the two genotypes of the molecular marker snpA03-1, which was significantly associated with silique number, in materials with extreme silique number was examined. The results showed that the genotype of the molecular marker snpA03-1 was GG genotype in all 20 materials with a small number of siliques, but only 11 of the 20 materials with a small number of siliques were GG (Table 1). In addition, the T-test results showed that the genotypes GG and AA detected by the molecular marker snpA03-1 had extremely significant differences in silique number traits (P=0....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker associated with the rape pod number and application. An SNP (single nucleotide polymorphism) marker significantly associated with the rape pod number is obtained, and located on the 19,267,907 base position of the rape A03 chromosome, 7.6% of the phenotypic variations can be explained; a primer designed according to the molecular marker is snpA03-1F:ATTTTCATTGATAAACATACCGAATT, snpA03-1R:TCAATTCATGCTGAAAATTAATGACTAT. By utilizing the marker for assisting in selection, the high-yield breeding efficiency of the rape can be improved.

Description

technical field [0001] The invention belongs to the technical field of molecular biology and genetic breeding, and in particular relates to a molecular marker primer related to the number of rape pods and its application. Background technique [0002] In recent years, the self-sufficiency rate of domestic vegetable oil in my country is only about 35%, which seriously threatens the security of edible oil supply in my country (Hua Wei et al., 2016). Rapeseed is the largest oil crop in my country (Hu et al., 2016), and rapeseed oil is the largest source of domestic edible vegetable oil. However, compared with Canada and other rapeseed exporting countries, my country's rapeseed industry has the problem of low oil production, which restricts its international competitiveness. In the situation where the scale of urbanization continues to expand and the area of ​​arable land is further reduced, the main way out is to continue to increase oil production per unit area. At present, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12N15/11
Inventor 王汉中师家勤李书宇王新发刘贵华詹杰鹏
Owner INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More