A Molecular Marker Primer Associated with Rapeseed Silique Number and Its Application
A technology of siliques and forward primers, applied in the fields of molecular biology and genetic breeding, can solve problems such as undiscovered, achieve the effects of reducing workload, speeding up the breeding process, and shortening the breeding cycle
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Acquisition of SNP markers significantly associated with rapeseed silique number:
[0028] (1) Collect 331 inbred lines of Brassica napus from various countries in the world as the core related population of rapeseed, collect individual leaves of each line of the related population, extract the total DNA by CTAB method, and use the rapeseed 60K SNP chip to analyze each sample Perform genotype analysis.
[0029] (2) Use the Illumina BeadStudio genotyping software (http: / / www.illumina.com / ) to calculate the marker heterozygous rate (heterozygous rate), missing rate (missing rate) and minimum allele of the population material at each locus Gene frequency (minor allele frequency). The deletion rate ≤ 0.2, the heterozygosity rate ≤ 0.2, the minimum allele frequency > 0.05, and the unique match of the SNP marker in the Brassica napus genome were used as the screening criteria to filter the SNP markers, and finally 24,508 high-quality SNP markers were obtained for the whole g...
Embodiment 2
[0033] Acquisition of a molecular marker primer significantly associated with the number of siliques in rapeseed:
[0034](1) Extract the sequence of 100 bp upstream and downstream of the 19th, 267, 907th base on the rape A03 chromosome, and develop the SNP marker primer snpA03-1 according to the primer design principle, the forward primer is snpA03-1F: ATTTTCATTGATAAACATACCGAATT, and the reverse primer is snpA03-1R ::TCAATTCATGCTGAAAATTAATGACTAT, the amplicon size is 152bp.
[0035] The sequence amplified in Brassica napus material 73290 is the GG genotype, and the sequence is as follows:
[0036] TAAACATACCGAATTCCTTTTTTTGTTTTGTTGAAACATATTGATTATGTTGAAACATATTGATTACCTTACAACGATTCGAAATGGTTTTTTTCACCTCTACGTCGGGAATCCAAACGTTATAAATAGTCATTAATTTTCAGCATGAATTGA
[0037] The sequence amplified in Brassica napus 51070 is the AA genotype, and the sequence is as follows:
[0038] TAAACATACCGAATTCCTTTTTTTGTTTTGTTGAAACATATTGATTATGTTGAAACATATTGATTACCTTACAACGATTCGAAATGGTTTTTTTCACCTCTACATCGGGAAT...
Embodiment 3
[0042] The application of primers designed based on the 19,267,907th base on the rapeseed A03 chromosome in screening breeding for the number of rapeseed siliques, the steps are as follows:
[0043] (1) Select 20 multi-silique materials (over 70 siliques in the main inflorescence) and 20 low-silique materials (less than 45 siliques in the main inflorescence) among 331 associated populations.
[0044] (2) The distribution of the two genotypes of the molecular marker snpA03-1, which was significantly associated with silique number, in materials with extreme silique number was examined. The results showed that the genotype of the molecular marker snpA03-1 was GG genotype in all 20 materials with a small number of siliques, but only 11 of the 20 materials with a small number of siliques were GG (Table 1). In addition, the T-test results showed that the genotypes GG and AA detected by the molecular marker snpA03-1 had extremely significant differences in silique number traits (P=0....
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap