Application of a monoclonal antibody in early pregnancy detection of dairy cows and its kit
A monoclonal antibody, early pregnancy technology, applied in the fields of preparation, hybridoma cell lines, applications and kits, monoclonal antibody, can solve the problems of unknown mechanism of action and functional application, shorten the empty pregnancy period, broad application prospects, cost-saving effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035]Example 1: Recombinant baculovirus rBV-hp infects sf9 cells to express Hp
[0036]1. Design of primers
[0037]According to the Hp gene sequence published on GeneBank (NM_001040470), design a pair of specific primers F to amplify Hp gene1 / F2, And insert the NcoI restriction site in the upstream primer, and insert the HindIII restriction site in the downstream primer. The primers were synthesized by Dalian Bao Biological Engineering Co., Ltd. The primers are as follows:
[0038]F1: AAACCATGG CGATGAGCGCCCTGCAA
[0039]NCOI
[0040]F2:TTTAAGCTTTTAGTTGTTAGCGATGG
[0041]HindIII
[0042]2. PCR amplification
[0043]The HP gene fragment was amplified using the RNA from the blood of pregnant cows isolated in our laboratory. The amplification conditions were: ①94℃3 minutes, ②(94℃30 seconds→55℃30 seconds→72℃1 minute 30 seconds) 35 cycles; ③72°C for 10 minutes. After the reaction, it was detected by 0.8% agarose gel electrophoresis.
[0044]3. Construction of recombinant transfer plasmid pFastBacHTB-Hp
[0045]The P...
Embodiment 2
[0056]Example 2: Preparation of monoclonal antibodies
[0057]1) Preparation of monoclonal antibodies
[0058]After the Hp protein expressed by the recombinant baculovirus is purified by column, the protein concentration is calculated according to the formula. The Hp protein was used as an antigen to immunize BALB / C mice.
[0059]The purified Hp protein was used as an immune antigen to immunize 6-week-old female BABLB / C mice for 5 times with an interval of 2-3 weeks. For the first immunization, Hp protein plus an equal amount of Freund's complete adjuvant, the immunization dose was 100 μg / mouse, and the immunization route was subcutaneously injected at multiple points on the back of the neck. Later, Freund's incomplete adjuvant was used. A small amount of blood is collected from the tail 12-15 days after the fourth immunization, and the serum titer is determined by indirect ELISA. If the serum titer is qualified, a booster immunization will be performed three days after fusion. With Hp prote...
Embodiment 3
[0077]Example 3: Hybridoma cell lines secreting monoclonal antibodies against Hp protein
[0078]The embodiment of the present invention discloses a hybridoma cell line that secretes monoclonal antibodies against Hp protein: the hybridoma cell line is a hybridoma cell line of CCTCC NO: C2017119 (ie hybridoma cell line 4F11) And CCTCC NO: C201858 hybridoma cell line (ie hybridoma cell line 12F9).
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com