Supercharge Your Innovation With Domain-Expert AI Agents!

Primer set and kit for detecting four mutations of SLC25A13 gene and application thereof

A technology for detection kits and detection primers, which is applied in the direction of recombinant DNA technology, microbial measurement/inspection, biochemical equipment and methods, etc., can solve the problem of clinical detection of no disease, etc., and achieve low cost, high sensitivity and high specificity Effect

Inactive Publication Date: 2019-04-16
江门市妇幼保健院
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the variety of gene mutation types and types, there is currently no suitable detection method for the clinical detection of this disease

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer set and kit for detecting four mutations of SLC25A13 gene and application thereof
  • Primer set and kit for detecting four mutations of SLC25A13 gene and application thereof
  • Primer set and kit for detecting four mutations of SLC25A13 gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] Example 1 Primer Sets and Probes

[0069] 1.1 For the type I mutation of SLC25A13, search the sequence in NCBI and design primers and probes. A total of 2 primers and 1 Taqman probe were designed.

[0070] SLC25A13 type I primer F: CCAAACTGAAGGCTATACTGA (SEQ ID NO.1);

[0071] SLC25A13 type I primer R: CCTCTTCCAGAGGAGCA (SEQ ID NO.2);

[0072] SLC25A13 Type I Probe:

[0073] 5'FAM-TTGTTTTTCCCCTACAGACGTATGACCTTAGCAG-3'BHQ1 (SEQ ID NO. 3).

[0074] 1.2 For the type III mutation of SLC25A13, search the sequence in NCBI and design primers and probes. A total of 2 primers and 1 Taqman probe were designed.

[0075] SLC25A13 type III primer F: GACTGAGATGGTGTTGTGT (SEQ ID NO.4);

[0076] SLC25A13 type III primer R: ACTCCGCTGTAAGTGGTT (SEQ ID NO.5);

[0077] SLC25A13 Type III probe:

[0078] 5'CY5-GAGATTACAGGTGGCTGCCCGGGGAGATTACAG-3'BHQ2 (SEQ ID NO. 6).

[0079] 1.3 For the X-type mutation of SLC25A13, search the sequence in NCBI and design primers and probes. A total of ...

Embodiment 2

[0095] An embodiment of the detection kit of the Citrin deficiency disease-causing gene mutation of the present invention, comprising the primer set of embodiment 1, PCR buffer, Mg 2+ , dNTPs and DNA polymerase; PCR buffer contains Tris-HCl and KCl.

[0096] In this embodiment, the SLC25A13 genotype of Citrin deficiency patients and normal people was detected by using the detection kit for the mutation of the Citrin deficiency disease-causing gene; specifically, when the detection kit is used, the following aspects are included:

[0097] 1. The components of the PCR reaction system are shown in Table 1:

[0098] Table 1 PCR reaction system

[0099]

[0100] 2. The PCR reaction program is shown in Table 2:

[0101] Table 2 PCR reaction program

[0102]

[0103] 3. Genotyping criteria

[0104] 3.1 Amplification curve

[0105] When the amplification curve is smooth, showing an "S" shape, and the Ct value is less than or equal to 30, the genotyping can be judged.

[01...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
melting pointaaaaaaaaaa
melting pointaaaaaaaaaa
melting pointaaaaaaaaaa
Login to View More

Abstract

The invention discloses a primer set for detecting four mutations of an SLC25A13 gene and application thereof. The invention also discloses a detection kit for Citrin deficiency pathogenic gene mutations. The detection kit comprises the primer set, a PCR buffer, Mg2+, dNTPs and DNA polymerase. The PCR buffer contains Tris-HCl and KCl. The kit detects the mutations of the SLC25A13 gene by using a multi-color probe melting curve technology, relates to a fluorescent PCR technology, an asymmetric PCR technology, a multiplex PCR technology and a melting curve analysis technology, and achieves simultaneous detection of the wild type mutation, the heterozygous mutation and the homozygous mutation of 851_854del (type I), 1638_1660dup (type III), IVS6+5G) A (type X) and IVS16ins3kb (type XIX) through one PCR reaction. The method has the advantages of simple operation, high sensitivity, high specificity and low cost.

Description

technical field [0001] The invention relates to the technical field of gene detection, in particular to a primer set, a kit and an application thereof for detecting four mutations of the Citrin deficiency pathogenic gene SLC25A13. Background technique [0002] Citrin deficiency (Citrin Deficiency, CD) is an autosomal recessive genetic disease caused by SLC25A13 gene mutation. The SLC25A13 gene is located on human chromosome 7q21.3, contains 18 exons, and its open reading frame is 2028bp in length, encoding an aspartic acid / glutamic acid carrier subtype 2 (Aspartate / Glutamate Carrier isoform 2, AGC2). The role of AGC2 is to exchange the aspartic acid synthesized by the mitochondrial matrix with the glutamic acid in the cell cytoplasm, and at the same time provide a proton to the mitochondria, and when the SLC25A13 gene mutation can affect the activity of AGC2, a series of complex Metabolic disorders, and eventually Citrin deficiency. Citrin deficiency currently has three ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883C12N15/11
CPCC12Q1/6883C12Q2600/156
Inventor 曾钦龙曹克慎李玉萍唐佳
Owner 江门市妇幼保健院
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More