Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for specifically inhibiting pain generation and transfer by using TRPV1 promoter and optogenetics measures

An optogenetics and pain-inhibiting technology, which is applied in the field of specific inhibition of pain generation and transmission by using TRPV1 promoter and optogenetics, can solve the problem of non-specificity of pain

Pending Publication Date: 2019-03-29
上海树突精密仪器有限公司
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, there is no specificity for the treatment of pain. The present invention uses a specific promoter to drive the specific expression of light-inhibitory sensitive protein in the nociceptor of dorsal root ganglion (DRG), so as to achieve the effect of specifically inhibiting pain. Purpose

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for specifically inhibiting pain generation and transfer by using TRPV1 promoter and optogenetics measures
  • Method for specifically inhibiting pain generation and transfer by using TRPV1 promoter and optogenetics measures
  • Method for specifically inhibiting pain generation and transfer by using TRPV1 promoter and optogenetics measures

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0016] 1. PCR reaction system and product purification

[0017] The restriction site SnaBI and XhoI were introduced to amplify the target fragment of TRPV1 promoter.

[0018] Upstream primer SnaBI TRPV1F: GCATACGTAGAGGACCAGAAGAAGGAGAGTC

[0019] Downstream primer XhoI TRPV1R: GTACTCGAGGTGCAGGCACACTCCAAATG

[0020] PCR reaction system:

[0021]

[0022] PCR cycle system:

[0023]

[0024] 2. Double enzyme digestion reaction system and product purification

[0025] 2.1 Digest the target fragment of the TRPV1 promoter recovered and purified from the gel with the pEGFP-N1 vector, and digest in a water bath at 30°C for 1 hour.

[0026] Double enzyme digestion reaction system:

[0027]

[0028] 2.2 Purification of double digestion product

[0029] The double-digested products were subjected to agarose gel electrophoresis and then gel-sliced, recovered and purified with the Axygene Gel Extraction Kit.

[0030] 3. Using the TRPV1 promoter to express the target gene in ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for specifically inhibiting the excitation of pain neurons in body and further inhibiting pain generation and transfer by using a TRPV1 promoter and optogenetics measures. The method is a novel noninvasive and specific pain relieving method, wherein the TRPV1 promoter drives a photo-inhibitive sensitive protein, ArchT, to be specifically expressed in a medium andsmall neuron, i.e. a nociceptor, in animal DRG; and when 532 nm green laser stimulation is delivered, the ArchT protein may pump the H<+> in a nerve cell out of the cell, so that the cell is hyperpolarized and inhibited, thus inhibiting pain. The method is a novel, noninvasive and specific pain relieving method. The invention certainly will lay excellent theoretical and practical basis to gene-therapy of analgesia.

Description

technical field [0001] The invention relates to a method for using TRPV1 promoter and optogenetic means to specifically inhibit the excitation of pain neurons in vivo, thereby inhibiting the generation and transmission of pain. It is widely used in the fields of biology, optogenetics and neuroscience, and specifically involves constructing a recombinant AAV virus (AAV5-TRPV1-ArchT-eGFP) with TRPV1 promoter, light-inhibitory sensitive protein ArchT and AAV5, and its Inject directly into the DRG of animals, and study its inhibitory effect on the nervous system and animal pain response after the target protein ArchT is expressed in a high amount and stably in the neuron cell membrane Background technique [0002] Chronic pain is a pathological condition that greatly reduces people's quality of life. However, so far, there is still no specific treatment for chronic pain. Currently available analgesic drugs are both poorly targeted and have serious side effects. Therefore, it ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/864C12N15/12A01K67/027A61K49/00
CPCA61K49/0008A01K67/0275C12N15/86C07K14/4703A01K2207/05A01K2227/105C12N2750/14143C12N2800/107C12N2830/008
Inventor 李倍蒋礼阳
Owner 上海树突精密仪器有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com