Application and breeding method of serpinA3 and vitronectin gene in breeding of Sujiang boar
A gene and boar technology, applied in the field of Sujiang boar breeding, can solve problems such as the impact of body weight on feed efficiency, uncertainty in energy measurement, and fluctuations in feed intake, so as to save pig raising cycle, Accurate and rapid selection, high feed efficiency results
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0068] Example 1. Evaluation of Sujiang boars with low RFI levels
[0069] 1. Determination of phenotypic data
[0070] Select Sujiang back-up boars with an initial body weight of 30KG, a total of 56, and feed rations with reference to the standard given in "Lean Meat Pig Raising Technology" (Zhou Guanghong. Lean Meat Pig Raising Technology. Beijing: Jindun Publishing Society, 2008), the final body weight was 90KG. During the collection of phenotypic data, use the breeding pig performance measurement system or artificial feeding to measure and record the initial test age, average daily gain, average daily feed intake and feed consumption, and use the live backfat meter to measure the backfat thick. The measurement results are shown in Table 1.
[0071] Table 1 Determination results of each character
[0072]
[0073] 2. RFI data model fitting and calculation
[0074] Based on the measurement results of phenotypic data (see Table 1), the optimal RFI model of pigs was an...
Embodiment 2
[0102] Example 2. Screening of alleles that have a significant impact on feed efficiency
[0103] One, collect 220 parts of blood from the Sujiang pig boar used in embodiment 1, utilize Na-OH two-step method to extract DNA, method is as follows: FTA card punches (diameter 1.2mm) sampling, 200 microliters 20mMNaOH soaks Take the blood sample for 30 minutes, absorb the color-changing liquid and add 200 microliters of 1 times TE and let it stand at room temperature for 5 minutes, absorb the residual liquid and perform the following steps after the blood sample is dried.
[0104] 2. Allele typing analysis
[0105] The primers used in PCR amplification are as follows:
[0106] The amplification primer pair (primer pair 1) of serpinA3 gene is:
[0107] Upstream primer (SEQ ID NO 1): AGCCTTTTCACCCTTTCTAGGCCG
[0108] Downstream primer (SEQ ID NO 2): GTAGAGGCTGAAGGCGAAGTCA
[0109] The amplification primer pair (primer pair 2) of vitaminectin gene is:
[0110] Upstream primer (SE...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap