Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Nucleic acid aptamer specifically targeting Trachinotus ovatus nerve necrosis virus and application thereof

A technology of nucleic acid aptamer and ovoid pomfret, applied in biochemical equipment and methods, instruments, analytical materials, etc., can solve the problems of detection and diagnosis of necrosis virus derived from ovate pomfret, and achieve good application prospects , Small molecular weight, easy to mark effect

Active Publication Date: 2019-01-15
GUANGXI ACAD OF SCI
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The present invention is to provide a high specificity, high sensitivity, non-immunogenicity, stable and easy to modify, easy to synthesize and store ssDNA nucleic acid aptamer for detecting neuronecrosis virus derived from pompano pomfret, to at least solve the problem The problem that some biological detection techniques cannot quickly and accurately detect and diagnose the neuronecrosis virus of pomfret ovata on the spot

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid aptamer specifically targeting Trachinotus ovatus nerve necrosis virus and application thereof
  • Nucleic acid aptamer specifically targeting Trachinotus ovatus nerve necrosis virus and application thereof
  • Nucleic acid aptamer specifically targeting Trachinotus ovatus nerve necrosis virus and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 The preparation method of ssDNA nucleic acid aptamer is as follows:

[0035] Step 1: Synthesize the single-stranded DNA library and primers shown in the following sequences:

[0036] Random library Library50:

[0037] 5'-GTCTGAAGTAGACGCAGGAG(50N)AGTCACACCTGAGTAAGCGT

[0038] 5' primer: 5'-FAM-GTCTGAAGTAGACGCAGGAG-3';

[0039] 3' Primer: 5'-Biotin-ACGCTTACTCAGGTGTGACT-3';

[0040] Step 2: Dissolve 10 nmol of the above random library in 500 μl PBS, place in a constant temperature water bath at 92°C for 5 minutes, then quickly ice-bath for 10 minutes, take the treated random library and incubate GTONNV-infected cells on ice for 1 hour; wait for incubation After the combination is completed, centrifuge and remove the supernatant, take 10mL of PBS to wash the GTONNV infected cells, and in a constant temperature water bath at 92°C for 10min, centrifuge at 12000g for 1-20min, and collect the supernatant, which is To specifically recognize the ssDNA nucleic acid a...

Embodiment 2

[0052] The preparation method of embodiment 2 ssDNA nucleic acid aptamer is as follows:

[0053] Step 1: Synthesize the single-stranded DNA library and primers shown in the following sequences:

[0054] Random library Library50:

[0055] 5'-GTCTGAAGTAGACGCAGGAG(50N)AGTCACACCTGAGTAAGCGT

[0056] 5' primer: 5'-FAM-GTCTGAAGTAGACGCAGGAG-3';

[0057] 3' Primer: 5'-Biotin-ACGCTTACTCAGGTGTGACT-3';

[0058] Step 2: Dissolve 10 nmol of the above random library in 500 μl PBS, place in a constant temperature water bath at 92°C for 5 minutes, then quickly ice-bath for 10 minutes, take the treated random library and incubate GTONNV-infected cells on ice for 1 hour; wait for incubation After the combination is completed, centrifuge and remove the supernatant, take 10mL of PBS to wash the GTONNV infected cells, and in a constant temperature water bath at 92°C for 10min, centrifuge at 12000g for 1-20min, and collect the supernatant, which is To specifically recognize the ssDNA nucleic aci...

Embodiment 3

[0082] The secondary structure of the nucleic acid aptamer was predicted online by MFOLD software.

[0083] The secondary structure prediction results of the nucleic acid aptamer of SEQ ID NO:1 are as follows image 3 As shown, the nucleic acid aptamer forms a special stem-loop structure and hairpin structure.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an ssDNA nucleic acid aptamer specifically targeting Trachinotus ovatus nerve necrosis virus and application thereof, wherein the nucleotide sequence of the ssDNA nucleic acidaptamer is 5'-GTCTGAAGTAGACGCAGGAGAACTGTATTAGCCTCTGGGTGCCGCACCGTAGTGCCCTATCTAACATCACAGTCACACCTGAGTAAGCGT-3' (SEQ ID NO: 1) or 5'-AACTGTATTAGCCTCTGGGTGCCGCACCGTAGTGCCCTATCTAACATCAC-3' (SEQ ID NO:2). The ssDNA nucleic acid aptamer of the invention has specificity and high sensitivity to nerve necrosis virus infected cells of Trachinotus ovatus , and has no immunogenicity. The ssDNA nucleic acid aptamer has high specificity, high affinity, no cytotoxicity, stable and easy to modify, easy to synthesize and preserve, and can be used for rapid and accurate detection and diagnosis of nerve necrosis virus infected cells of Trachinotus ovatus.

Description

technical field [0001] The invention relates to a ssDNA nucleic acid aptamer and its screening method, detection method and application, in particular to a nucleic acid aptamer specific for the neuronecrosis virus of pompano pomfret and its application. Background technique [0002] As a big country in aquaculture, my country's aquaculture volume accounts for 70% of the world's total aquatic product farming. Guangxi is a large aquaculture province in my country, and the main cultured species include pomfret trevally, grass carp, channel catfish, grouper, prawns, oysters, pearl oyster and various edible plants. However, with the acceleration of urbanization, industrialization, and large-scale farming, the aquaculture environment in Guangxi is deteriorating day by day, and various diseases frequently break out, causing huge economic losses. In 2017, the viral neuronecrosis fish disease of pomfret ovata in offshore cage culture in Beihai, Guangxi broke out. Through the identif...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/115C12N15/10G01N33/569
CPCC12N15/1048C12N15/115C12N2310/16G01N33/56983
Inventor 李鹏飞余庆刘明珠李菲吴思婷肖贺贺
Owner GUANGXI ACAD OF SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More