Nucleic acid aptamer specifically targeting Trachinotus ovatus nerve necrosis virus and application thereof
A technology of nucleic acid aptamer and ovoid pomfret, applied in biochemical equipment and methods, instruments, analytical materials, etc., can solve the problems of detection and diagnosis of necrosis virus derived from ovate pomfret, and achieve good application prospects , Small molecular weight, easy to mark effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1 The preparation method of ssDNA nucleic acid aptamer is as follows:
[0035] Step 1: Synthesize the single-stranded DNA library and primers shown in the following sequences:
[0036] Random library Library50:
[0037] 5'-GTCTGAAGTAGACGCAGGAG(50N)AGTCACACCTGAGTAAGCGT
[0038] 5' primer: 5'-FAM-GTCTGAAGTAGACGCAGGAG-3';
[0039] 3' Primer: 5'-Biotin-ACGCTTACTCAGGTGTGACT-3';
[0040] Step 2: Dissolve 10 nmol of the above random library in 500 μl PBS, place in a constant temperature water bath at 92°C for 5 minutes, then quickly ice-bath for 10 minutes, take the treated random library and incubate GTONNV-infected cells on ice for 1 hour; wait for incubation After the combination is completed, centrifuge and remove the supernatant, take 10mL of PBS to wash the GTONNV infected cells, and in a constant temperature water bath at 92°C for 10min, centrifuge at 12000g for 1-20min, and collect the supernatant, which is To specifically recognize the ssDNA nucleic acid a...
Embodiment 2
[0052] The preparation method of embodiment 2 ssDNA nucleic acid aptamer is as follows:
[0053] Step 1: Synthesize the single-stranded DNA library and primers shown in the following sequences:
[0054] Random library Library50:
[0055] 5'-GTCTGAAGTAGACGCAGGAG(50N)AGTCACACCTGAGTAAGCGT
[0056] 5' primer: 5'-FAM-GTCTGAAGTAGACGCAGGAG-3';
[0057] 3' Primer: 5'-Biotin-ACGCTTACTCAGGTGTGACT-3';
[0058] Step 2: Dissolve 10 nmol of the above random library in 500 μl PBS, place in a constant temperature water bath at 92°C for 5 minutes, then quickly ice-bath for 10 minutes, take the treated random library and incubate GTONNV-infected cells on ice for 1 hour; wait for incubation After the combination is completed, centrifuge and remove the supernatant, take 10mL of PBS to wash the GTONNV infected cells, and in a constant temperature water bath at 92°C for 10min, centrifuge at 12000g for 1-20min, and collect the supernatant, which is To specifically recognize the ssDNA nucleic aci...
Embodiment 3
[0082] The secondary structure of the nucleic acid aptamer was predicted online by MFOLD software.
[0083] The secondary structure prediction results of the nucleic acid aptamer of SEQ ID NO:1 are as follows image 3 As shown, the nucleic acid aptamer forms a special stem-loop structure and hairpin structure.
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com