Lipidosome composite as well as application and method for reducing content of biogenic amine in mackerel fish sauce
A technology of liposome complexes and cationic liposomes, applied in biochemical equipment and methods, food science, DNA/RNA fragments, etc., can solve problems such as difficult degradation, difficult application and promotion, and ineffective effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Preparation of liposome complexes:
[0039] (1) si-luxR Design and synthesize the molecule si-luxR that interferes with the luxR gene according to the amine-related gene luxR (see Appendix) of the main amine-producing bacterium Enterobacter cloacae in fish sauce. The si-luxR sequence is:
[0040] Justice Chain: UUAAUAUGCAAGUUUAGCGAG;
[0041] Antisense strand: CGCUAAACUUGCAUAUUAAGA.
[0042] T7 promoter template DNA is 5'-TAATACGACTCACTATAGGAGACAGG-3'.
[0043] (2) Synthesis of si-luxR by in vitro transcription method: Mix 3 μL siRNA sense strand (100 μmol / L) and 3 μL T7 promoter primer template (100 μmol / L), pre-denature at 95°C for 3 minutes, ice-bath for 25 minutes, and then add 3 μL 10xKlenow buffer, 8 μL deoxynucleoside triphosphate (dNTP) (10 μmol / L), 2 μL ddH2O, 2.5 μL Klenow enzyme (2U / uL), 37 ° C water bath for 30 minutes. Take 6 μL of reaction solution, add 4 μL of buffer, 5 μL of nucleoside triphosphate (rNTP) mixture (25 mmol / L), 2.5 μL of ddH2O and 2.5 ...
Embodiment 2
[0055] Preparation of liposome complexes:
[0056] Wherein the preparation of si-luxR is the same as in Example 1.
[0057] (1) Preparation of blank cationic liposomes: Weigh 25 mg of soybean lecithin, N-(1-(2,3 dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP ) 35 mg, cholesterol 25 mg, distearoylphosphatidylethanolamine-polyethylene glycol (DSPE-PEG2000) 15 mg, dissolved in chloroform-methanol (volume ratio 3:2), and rotary evaporated to form a film. The thin lipid film was hydrated in a 5% glucose solution followed by shaking and the resulting liposomes were extruded 8 times through a 100 nm polycarbonate membrane to obtain a cationic liposome solution of approximately 10 mg / mL.
[0058] (2) Preparation of liposome complex L-ecl-si-luxR: si-luxR and blank cationic liposome were respectively dissolved in 1% diethylpyrocarbonate water, and mixed overnight. And the ratio of the total positive charges carried by cationic liposomes to the total negative charges carr...
PUM
Property | Measurement | Unit |
---|---|---|
particle diameter | aaaaa | aaaaa |
particle diameter | aaaaa | aaaaa |
particle diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com