Supercharge Your Innovation With Domain-Expert AI Agents!

Primer, probe and kit for detecting brucella based on recombinase polymerase amplification method

A technology of recombinant enzyme polymerase and detection kit, which is applied in the field of microbial diagnosis, can solve problems such as inability to achieve rapid clinical diagnosis, and achieve the effect of simple and fast operation, high sensitivity and strong specificity

Inactive Publication Date: 2018-06-29
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF2 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the application of the above-mentioned technologies can only be carried out in the laboratory, and it is impossible to achieve rapid clinical diagnosis.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, probe and kit for detecting brucella based on recombinase polymerase amplification method
  • Primer, probe and kit for detecting brucella based on recombinase polymerase amplification method
  • Primer, probe and kit for detecting brucella based on recombinase polymerase amplification method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Select specific conserved regions based on the pb26 gene sequence of Brucella melitensis, and design the common PCR primers and RPA primers and probes of pb26 gene. The target fragment size is 340bp. All primers are synthesized by Shanghai Shenggong Bioengineering Co., Ltd. The probe sequence has the fluorescent group FAM and the quenching group BHQ1, the two groups are separated by THF, and the 3'end is modified by phosphorylation. The designed primers are SEQ ID No.1 and SEQ ID No.2.

[0036] SEQ ID No. 1: 5'-CAATGTTGGAAAAATTTTGGATGAATCCGT-3';

[0037] SEQ ID No. 2: 5'-TTACTTGATTTCAAAAACGACATTGACCGATA-3'’;

[0038] SEQ ID No. 3: 5'-GGCGGTGATTTGAACCTGGTCAATGATAA(FAM-dt)C(THF)C(BHQ)CCGCCGTGATCAAC-P-3'.

[0039] SEQ ID No.4: 5'-TGTAGGAGATTTTATGAACACTCGTGCTAGCAATTTTCTCGCAGCCTCATTTTCCACAATCATGCTCGTCGGCGCTTTCAGCCTGCCCGCTTTCGCACAGGAGAATCAGATGACGACGCAGCCCGCGCGCATCGCCGTCACCGGGGAAGGCATGATGACGGCCTCGCCCGATATGGCCATTCTCAATCTCTCGGTGCTACGCCAGGCAAAGACCGCGCGCGAAGCCATGACCGCGAATAATGAAGCCATGACAA...

Embodiment 2

[0046] Using Exo kit to detect Chlamydia specific fluorescence RPA

[0047] 4.1 Specific fluorescence RPA detection

[0048] Using SEQ ID No. 3 as the probe, SEQ ID No. 1 and SEQ ID No. 2 as primers, and the vaccine strain of Brucella melitensis M5-90△26 (Lanzhou Institute of Veterinary Medicine, Chinese Academy of Agricultural Sciences and Harbin, Chinese Academy of Agricultural Sciences) Vaccine jointly constructed by the Institute of Veterinary Medicine), Brucella ovis M5 wild strain, Chlamydia abortus, Toxoplasma gondii, and Campylobacter fetus genomic DNA as the detection targets, with Brucella DNA as a positive control, provided by the present invention The primer probe set in the kit is amplified according to the instructions of the TwistAmpBasic kit kit, and the signal is detected by a fluorescent quantitative PCR instrument.

[0049] The detailed operation steps are as follows: Use TwistAmp Basic kit to prepare 50μL RPA reaction system, in which RPA-F and RPA-R (both 10μM) ...

Embodiment 3

[0055] Sensitivity analysis of fluorescence RPA detection

[0056] 1. Construction of plasmid standards

[0057] (1) Acquisition of bp26 gene

[0058] The upstream and downstream primers of the common PCR amplification primers are named SEQ ID No. 5 and SEQ ID No. 6, respectively. SEQ ID No. 4 and SEQ ID No. 5 are shown below. The RPA primers need to be further screened. FP: 5’-ATCCACCAGTCTCACGGTTC-3’, which is SEQ ID No. 5

[0059] RP: 5’-GGCGTCATACCCCAGCTAT-3’, which is SEQ ID No. 6

[0060] The PCR amplification primers SEQ ID No.5 and SEQ ID No.6 of gene bp26 were used to amplify the genome of Brucella M5 wild strain. The 50μL PCR reaction system is as follows: upstream primer, 1μL; downstream primer , 1μL; ExTaq premix enzyme, 25μL; template (genome), 2μL; deionized water, 21μL. PCR amplification procedure: first fully denatured at 95°C for 5 min; then 35 cycles, respectively: denaturation at 94°C for 30s; annealing at 56°C for 30s; extension at 72°C for 1 min, and finally at 72...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a primer, a probe and a kit for detecting brucella based on a recombinase polymerase amplification method and belongs to the technical field of microbiological diagnosis. The primer pair and the probe for detecting brucella based on the recombinase polymerase amplification method are designed and obtained by taking a specific conservative region of a brucella ovis pb 26 genesequence as a template. When the kit is used for detecting the pb 26 gene of the brucella by using the recombinase polymerase amplification method, the detection sensitivity reaches up to 6 CFU; meanwhile, the primer has high specificity in detection of the brucella.

Description

Technical field [0001] The invention belongs to the technical field of microbial diagnosis, and specifically relates to a primer, a probe and a kit for detecting Brucella based on a recombinase polymerase amplification method. Background technique [0002] Brucella is a gram-negative facultative intracellular parasitic bacteria, which widely infects domestic animals, wild animals and humans. Domestic animal Brucella mainly infects sheep, cattle and pigs, among which the pathogenic bacteria to humans Mainly Brucella malta and Brucella abortus; brucellosis infects domestic animals and causes epididymitis in male animals and abortion, placental inflammation and infertility in pregnant domestic animals; for humans, brucellosis can cause acute inflammation And many flu-like symptoms, including wave fever, sweating, back pain, and weakness. In some patients, acute clinical symptoms can last for more than a year, eventually leading to chronic persistent infections. Chronic clinical sy...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/689C12Q1/6844C12Q1/04C12N15/11C12R1/01
CPCC12Q1/6844C12Q1/689C12Q2521/507C12Q2522/101C12Q2531/119
Inventor 付宝权穆赛福·穆罕默德周继章李兆才娄忠子
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More