Application of DNA nanoribbon in apoptosis resistance and preparation method of DNA nanoribbon
A technology of nanobelt and DNA chain, applied to the application of DNA nanobelt in anti-apoptosis and the field of preparation thereof, can solve the problems of difficult preparation of target protein for market promotion, uncontrollable effect, difficult preparation of protein, etc., and achieve accurate Controllable inhibition of apoptosis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] A DNA nanobelt (hereinafter referred to as DNR) is used in anti-apoptosis, and the DNA nanobelt is composed of four of SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 Made of DNA strands. The DNA nanoribbon was synthesized by DNA origami technique.
[0026] The above DNR preparation steps are as follows:
[0027] S1, prepare the following four DNA strands (artificially synthesized by Invitrogen Company) with a concentration of 100 μmol / L, for future use:
[0028] Staple 1:5'-cagccctgtaagatgaagatagcgtctatgcc-3', as shown in SEQ ID NO.1;
[0029] Staple 2:5'-ccctgactcaca atggtcggattccgtctctg-3', as shown in SEQ ID NO.2;
[0030] Staple 3:5'-tctcaacttcaactcgtattctca actcgtat-3', as shown in SEQ ID NO.3;
[0031] Scaffold strands:
[0032] 5'-cagggctgggcatagaagtcagggcagagacgagttgagaatacgagttgagaatacgagttgagaatccgacc attgtgcgctatcttcatctta-3', as shown in SEQ ID NO.4;
[0033] Prepare 10×TA / Mg solution according to the following formula: 2.42g tris, 1.34g magnesium ...
Embodiment 2
[0046] A kind of application of DNA nanobelt (being called as DNR) on anti-apoptosis, and described DNA nanobelt is by SEQID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 institute prepared from the four DNA strands described above. The DNA nanoribbon was synthesized by DNA origami technique.
[0047] The above-mentioned DNR nanoribbon preparation steps are as follows:
[0048] S1, prepare the following four DNA strands (artificially synthesized by Invitrogen Company) with a concentration of 100 μmol / L, for future use:
[0049] Staple 1:5'-cagccctgtaagatgaagatagcgtctatgcc-3', as shown in SEQ ID NO.1;
[0050] Staple 2:5'-ccctgactcaca atggtcggattccgtctctg-3', as shown in SEQ ID NO.2;
[0051] Staple 3:5'-tctcaacttcaactcgtattctca actcgtat-3', as shown in SEQ ID NO.3;
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap