Supercharge Your Innovation With Domain-Expert AI Agents!

Application of DNA nanoribbon in apoptosis resistance and preparation method of DNA nanoribbon

A technology of nanobelt and DNA chain, applied to the application of DNA nanobelt in anti-apoptosis and the field of preparation thereof, can solve the problems of difficult preparation of target protein for market promotion, uncontrollable effect, difficult preparation of protein, etc., and achieve accurate Controllable inhibition of apoptosis

Active Publication Date: 2018-06-22
NORTHWEST UNIV(CN)
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The above traditional methods are cumbersome and difficult to control. Some target proteins are difficult to prepare and put into the market, and the effect is uncontrollable
For example, the expression gene of the survivin protein in the AP family is only expressed in tumors and embryonic tissues, but it is rarely expressed in normal adult tissues. Although this protein can be produced under the existing technical conditions, it needs to be simulated in vitro. The gene transcription and expression environment is a relatively big challenge, which makes it difficult to produce the protein; most substances in the Bcl-2 family have both anti-apoptotic and pro-apoptotic effects, and improper control may cause the opposite effect. Effect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of DNA nanoribbon in apoptosis resistance and preparation method of DNA nanoribbon
  • Application of DNA nanoribbon in apoptosis resistance and preparation method of DNA nanoribbon
  • Application of DNA nanoribbon in apoptosis resistance and preparation method of DNA nanoribbon

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] A DNA nanobelt (hereinafter referred to as DNR) is used in anti-apoptosis, and the DNA nanobelt is composed of four of SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 Made of DNA strands. The DNA nanoribbon was synthesized by DNA origami technique.

[0026] The above DNR preparation steps are as follows:

[0027] S1, prepare the following four DNA strands (artificially synthesized by Invitrogen Company) with a concentration of 100 μmol / L, for future use:

[0028] Staple 1:5'-cagccctgtaagatgaagatagcgtctatgcc-3', as shown in SEQ ID NO.1;

[0029] Staple 2:5'-ccctgactcaca atggtcggattccgtctctg-3', as shown in SEQ ID NO.2;

[0030] Staple 3:5'-tctcaacttcaactcgtattctca actcgtat-3', as shown in SEQ ID NO.3;

[0031] Scaffold strands:

[0032] 5'-cagggctgggcatagaagtcagggcagagacgagttgagaatacgagttgagaatacgagttgagaatccgacc attgtgcgctatcttcatctta-3', as shown in SEQ ID NO.4;

[0033] Prepare 10×TA / Mg solution according to the following formula: 2.42g tris, 1.34g magnesium ...

Embodiment 2

[0046] A kind of application of DNA nanobelt (being called as DNR) on anti-apoptosis, and described DNA nanobelt is by SEQID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 institute prepared from the four DNA strands described above. The DNA nanoribbon was synthesized by DNA origami technique.

[0047] The above-mentioned DNR nanoribbon preparation steps are as follows:

[0048] S1, prepare the following four DNA strands (artificially synthesized by Invitrogen Company) with a concentration of 100 μmol / L, for future use:

[0049] Staple 1:5'-cagccctgtaagatgaagatagcgtctatgcc-3', as shown in SEQ ID NO.1;

[0050] Staple 2:5'-ccctgactcaca atggtcggattccgtctctg-3', as shown in SEQ ID NO.2;

[0051] Staple 3:5'-tctcaacttcaactcgtattctca actcgtat-3', as shown in SEQ ID NO.3;

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biomedicine, and particularly relates to an application of a DNA nanoribbon in apoptosis resistance and a preparation method of the DNA nanoribbon. TheDNA nanoribbon synthesized by a DNA origami technology is applied to apoptosis resistance. Activity of cytochrome C peroxidase is inhibited by a DNA origami structure, and accordingly, the apoptosis resistance purpose is achieved, and the DNA nanoribbon is expected to provide important references in delivery systems for drugs for regulating the activity of cytochrome C enzyme as well as in targeted drug delivery.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and in particular relates to the application of a DNA nanobelt in anti-apoptosis and its preparation method. Background technique [0002] Apoptosis refers to the programmed cell death controlled by genes in order to maintain the stability of the human body environment. It is a basic biological phenomenon of cells, but the disordered apoptosis process is directly or indirectly related to the occurrence of many diseases. . Among them, cytochrome C is an important factor that is indispensable to participate in cell apoptosis. Cytochrome C is an embedded protein on the inner membrane of mitochondria, located outside the inner membrane of mitochondria, with a heme group, and acts as a single electron carrier in the membrane. Binding transfers electrons between complex III (Cyt c reductase) and complex IV (Cyt c oxidase). When the apoptosis signal is triggered, it will cause the release of cytoc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K31/711A61P43/00
CPCA61K31/711
Inventor 欧阳湘元王思尧任永安
Owner NORTHWEST UNIV(CN)
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More