Application of Lnc03729 gene as biomarker in lung adenocarcinoma pre-diagnosis reagent
A technology of lnc03729, 1.lnc03729 is applied in the application field of pre-diagnostic reagents, and can solve problems such as the down-regulation of Lnc03729
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] Example 1 Real-time fluorescence quantitative PCR method detects the low expression of Lnc03729 in lung adenocarcinoma:
[0021] 1. Materials and methods
[0022] 1.1 Materials
[0023] RNA extraction reagent Trizol (#9109, Takara);
[0024] Reverse Transcription Kit (#A3500, Promega);
[0025] SYBR® Premix Ex Taq™ fluorescent dye (#RR420A, Takara);
[0026] Nuclease-free water (#10977023, Invitrogen).
[0027] 1.2 Method
[0028] 24 pairs of lung adenocarcinoma and adjacent tissues were collected, total RNA was extracted, and 1 μg was reverse-transcribed to obtain a cDNA template. Real-time fluorescent quantitative PCR was used to detect the expression level of Lnc03729 in the two tissues. Lnc03729 gene forward primer: 5'-TTGGTGGATGCTGACCTTCA -3'; reverse primer: 5'- ACCAGAAACCAGATGTAGCCA -3'; internal reference gene β-Actin forward primer: 5'-CACCATTGGCAATGAGCGGTTC-3'; reverse primer: 5'- AGGTCTTTGCGGATGTCCACGT-3'. The real-time fluorescent quantitative PCR rea...
Embodiment 2
[0042] Example 2 Construction of H358 and A549 lung adenocarcinoma cell lines stably overexpressing Lnc03729:
[0043] 1. Materials and methods
[0044] 1.1 Materials
[0045] Human lung adenocarcinoma cells H358, A549 and human embryonic kidney cells 293T (ATCC);
[0046] DMEM medium, 1640 medium, DMEM / F12 medium, fetal bovine serum and trypsin (Gibco)
[0047] Overexpression of Lnc03729 vector (Shandong Weizhen Biotechnology);
[0048] Lentiviral packaging vector Gag-Pol, REV, VSV-G (addgene);
[0049] EcoliDH5α competent cells (#D9057, Takara);
[0050] Plasmid Extraction Kit (#D6943-01, OMEGA);
[0051]Transfect liposomes with Lipofectamine® RNAiMAX Reagent (#13778150, Thermo Fisher Scientific);
[0052] Puromycin puromycin (Amresco);
[0053] Cationic polymer Polybrene (#28728-55-4, Sigma);
[0054] RNA extraction reagent Trizol (#9109, Takara);
[0055] Reverse Transcription Kit (#A3500, Promega);
[0056] SYBR® Premix Ex Taq™ fluorescent dye (#RR420A, Takara);...
Embodiment 3
[0065] Example 3 After up-regulating the expression of Lnc03729 in lung adenocarcinoma cells H358 and A549, the cell proliferation ability decreased:
[0066] 1. Materials and methods
[0067] 1.1 Materials
[0068] Cell counting plate (#145-0011, Bio-Rad);
[0069] MTS (#G3580, promega).
[0070] 1.2 Method
[0071] MTS detection of cell proliferation ability
[0072] Inoculate overexpressed Lnc03729 H358 and A549 cells in good growth state and corresponding Vector control cells in a 96-well plate at 2000 cells / well, set up 5 parallel wells, discard the old medium after the cells adhere to the wall, and add MTS reagent Mix evenly with 1640 + 10% fetal bovine serum (A549 uses DMEM / F12 + 10% fetal bovine serum) medium at a ratio of 1:9, add 100 μl / well to the corresponding cell wells to be tested, incubate at 37°C for 1 h, and detect at 490 nm Absorbance. Similarly, the absorbance at 490 nm of the cells was detected at 24 h, 48 h, and 72 h, and the relative proliferation ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap