A kind of huperzine A derivative and preparation method thereof

A technology for huperzine A and derivatives, which is applied in the field of biomedicine and can solve the problems of insufficient structural diversity of huperzine A derivatives, cumbersome preparation process and the like

Active Publication Date: 2020-10-30
ZHEJIANG UNIV OF TECH
View PDF10 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to overcome the defects of the existing huperzine A derivatives such as the lack of structural diversity and cumbersome preparation process, and provide a new huperzine A derivative and its preparation method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of huperzine A derivative and preparation method thereof
  • A kind of huperzine A derivative and preparation method thereof
  • A kind of huperzine A derivative and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 Isolation of Irpex lacteus ZJUT-HS39

[0032] 1. Collection of samples

[0033] The samples were Huperziaserrata plants collected from Gaoer Township, Pan'an County, Jinhua City, Zhejiang Province in August 2016.

[0034] 2. Isolation of strains

[0035] Wash the collected plants with tap water, immerse them in a container containing 75% ethanol, take them out after 2 minutes, and rinse them with sterile water for 3-5 times; then immerse them in a container containing 0.1% mercuric chloride solution for 1 minute Then take it out, rinse with a large amount of sterile water to remove the residual mercuric chloride solution; under aseptic conditions, peel off the outer skin of the stem of Huperus serrata, then cut into 0.3cm × 0.3cm tissue pieces, and plant them in PDA ( Glucose 3g, potato extract powder 0.5g, KH 2 PO 4 0.2g, 1.5g of agar, add water to 100mL, pH value is natural) culture on the plate, after the colony appears, according to the shape of the c...

Embodiment 2

[0036] Example 2 Molecular Biological Identification of Irpex lacteus ZJUT-HS39

[0037] 1. Extraction of DNA

[0038] Take the fermented liquid cultured for 6 days, collect the mycelia by centrifugation, freeze and grind the mycelium with liquid nitrogen, and then use the SK1375 Genomic DNA Extraction Kit (Shanghai Bioengineering (Shanghai) Co., Ltd.) to extract genomic DNA and perform agarose gel Electrophoresis.

[0039] 2. PCR amplification of the sequence

[0040] The primer sequences are:

[0041] ITS1: 5'TCCGTAGGTGAACCTGCGG3';

[0042] ITS4: 5'TCCTCCGCTTATTGATATGC3'.

[0043] The PCR system (50 μL) is composed of: Template (genome) 10 pmol, primer 1 (10 μM) 1 μL, primer 2 (10 μM) 1 μL, dNTP mix (10Mm each) 1 μL, 10×Taq reaction buffer 5 μL, Taq (5U / μL) 0.25 μL, add water to 50 μL.

[0044] The PCR program was set as follows: 98°C pre-denaturation for 5 minutes, 95°C denaturation for 35 seconds, 55°C renaturation for 35 seconds, 72°C extension for 40 seconds, 35 cy...

Embodiment 3

[0049] Example 3 The method for preparing huperzine A derivatives by transforming Irpex lacteus ZJUT-HS39

[0050] 1. Preparation of Irpex lacteus ZJUT-HS39 fermentation product by fermentation culture

[0051] 1) Strain: Irpex lacteus ZJUT-HS39, the strain has been preserved in the China Center for Type Culture Collection, the preservation number is CCTCC M 2017161, the preservation date is March 31, 2017, and the preservation unit address is China , Wuhan, Wuhan University

[0052] 2) Cultivation and storage on slant

[0053] Solid medium: glucose 3g, potato extract powder 0.5g, KH 2 PO 4 0.2g, 1.5g agar, add water to 100mL, pH value is natural.

[0054] Solid culture method: Irpex lacteus ZJUT-HS39 strain is inoculated on a solid medium slant and cultured at 28°C for 5-7 days. After the solid culture is over, place the slant at 4-10°C and refrigerate for later use. Preparation of 30% glycerol cryovials: Under aseptic conditions, wash the slant of the test tube with 6...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the field of bio-medicine, and in particular to a huperzine A derivative which is obtained by conducting microbial transformation on huperzine A by virtue of irpex lacteus ZJUT-HS39 and is novel in structure, wherein the huperzine A derivative is shown as formula (1) (as shown in the Description). According to the preparation method of the huperzine A derivative provided by the invention, the huperzine A derivative is prepared by the following steps: inoculating a fermentation medium with the irpex lacteus, and meanwhile, adding the huperzine A as a substrate; conducting fermentation culture under conditions of 25-28 DEG C and 180rpm; and separating and purifying fermentation liquid. The huperzine A derivative provided by the invention, as a novel compound, is novel in structure; and up to now, there is no natural plant extracting method or chemical structure modifying method suitable for the preparation of the derivative. The preparation method provided by theinvention has the advantages of being simple in fermentation conditions, easy for culture of a strain, high in transformation rate and the like; and the preparation method is conducive to subsequentindustrial development.

Description

technical field [0001] The invention relates to the technical field of biomedicine, in particular to a novel huperzine A derivative and a microbial transformation method for preparing the derivative. Background technique [0002] Huperzine A (huperzine A) is an alkaloid derived from Huperzia serrate, a plant of the genus Lycopodium. Syndrome, at the same time has a significant effect on myasthenia gravis, memory impairment, vascular dementia. In recent years, huperzine A has been widely concerned by researchers, and the research hotspots mainly focus on the preparation of derivatives of this compound, activity evaluation, and structure-activity relationship. [0003] At present, there are mainly two methods for preparing huperzine A derivatives: 1. Extracting from Huperzine serrata plants. Extraction from natural sources is one of the common methods to obtain natural products and their derivatives. However, because Huperzia serrata belongs to higher ferns, it grows slowly...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12P17/12C12R1/645
Inventor 应优敏张才学占扎君单伟光
Owner ZHEJIANG UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap