Primer probes, kits and methods for precise quantitative detection of specific gene components of transgenic rice Kefeng No. 6 strain
A quantitative detection and genetically modified technology, applied in biochemical equipment and methods, microbial measurement/inspection, DNA/RNA fragments, etc., can solve the problems of increased detection difficulty and large quantity, and achieve accurate and sensitive results and accurate quantitative results , the effect of high detection sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] For the first time, the inventors of the present invention amplified the specific genes of the transgenic rice Kefeng No. 6 line by real-time fluorescent PCR (probe method). The probe sequence of the specific gene primers used for transgenic rice Kefeng No. 6 line is the upstream primer KF6-LFCACGACCCGGCCAGTTAAG (SEQ ID No.1), and the downstream primer is KF6-LR CATTAAGAACGTCCGCAATGTGT (SEQ ID No.2); the probe is KF6- LP CCCGAATTAATTCGGGGGATCTGGA (SEQ ID No. 3).
[0026] 1. Main testing instruments used:
[0027] Micropipette (eppendorf), fluorescent quantitative PCR instrument (AB7500), high-speed desktop centrifuge (12 000 r / min), electrophoresis instrument (DYY22C type), etc.
[0028] 2. Main reagents for detection:
[0029] 2×TaqMan Universal PCR Master Mix (ABI), primer probe (Thermofisher), etc.
[0030] 3. Main steps of detection:
[0031] Real-time fluorescent PCR reaction system:
[0032] 2×Mastermix 12.5μL
[0033] Upstream primer (10mM) 1.0μL
[0034] ...
Embodiment 2
[0046] In this example, the gene copy number of the transgenic rice was quantitatively detected by digital PCR by using the specific primer probe sequence of the transgenic rice Kefeng No. 6 line. The probe sequence of the transgenic rice Kefeng No. 6 line-specific primers used was KF6-LF CACGACCCGGCCAGTTAAG (SEQ ID No.1) for the upstream primer, and KF6-LRCATTAAGAACGTCCGCAATGTGT (SEQ ID No.2) for the downstream primer; the probe was KF6 -LP CCCGAATTAATTCGGGGGATCTGGA (SEQ ID No. 3) (SEQ ID No. 3).
[0047] 1. Main testing instruments used:
[0048] Micropipette (eppendorf), droplet digital PCR instrument (Bio-rad, QX200), high-speed desktop centrifuge (12 000 r / min), etc.
[0049] 2. Main reagents for detection:
[0050] 2×TaqMan Master Mix (Bio-rad), primer probe (Thermofisher), etc.
[0051] 3. Main steps of detection:
[0052] Digital PCR reaction system:
[0053] 2×Mastermix 10 μL
[0054] Upstream primer (10mM) 1.0μL
[0055] Downstream primer (10mM) 1.0μL
[0056...
Embodiment 3
[0065] The method is the same as that described in Example 2, except that the genomic DNA of the transgenic rice sample is first diluted 5 times and then diluted 10 times in 3 gradients as a template. Each dilution gradient is repeated 3 times, and the transgenic rice Kefeng No. 6 is used. The sequence of the amplification primer probe is the same as that in Example 2, and quantitative detection by digital PCR is carried out to determine the sensitivity of the method.
[0066] As shown in Table 1, the contents of the genomic DNA stock solution of transgenic rice samples diluted 5 times, 25 times, and 250 times were 168 copies / μL, 34.5 copies / μL, and 3.65 copies / μL, respectively, and the deviations from the theoretical values were - 2.44, 0.15, and 1.74, basically in line with the theoretical copy number, and the RSD values of the three replicates of each dilution gradient were 3.61%, 4.28%, and 13.8% (Table 1), indicating that this accurate quantitative detection method det...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com