Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of hsa_circRNA_102032 to liver cancer diagnosis, treatment and prognosis

An RNA primer, liver cancer technology, applied in the application field of circular hsa_circRNA_102032, can solve the problems of unexplained pathogenesis, pathological diagnosis and limitations of treatment methods, etc.

Active Publication Date: 2017-09-12
SHENZHEN DONGDA BIOTECH
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Primary liver cancer (PLC) is a type of malignant tumor that occurs in the liver. It usually develops from chronic liver disease or cirrhosis caused by chemical carcinogens or environmental factors. However, the pathogenesis has not yet been elucidated. Pathological diagnosis and treatment options have certain limitations

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of hsa_circRNA_102032 to liver cancer diagnosis, treatment and prognosis
  • Application of hsa_circRNA_102032 to liver cancer diagnosis, treatment and prognosis
  • Application of hsa_circRNA_102032 to liver cancer diagnosis, treatment and prognosis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] In the course of research on liver cancer, a circular RNA was discovered. Its sequence is:

[0025] CTAGAGTTGGGAAGACATCACTGATTATGTCTCTGGTCAGTGAAGAATTTCCAGAAGAGGTTCCTCCCCGGGCAGAAGAAATCACCATTCCAGCTGATGTCACCCCAGAGAGAGTTCCAACACACATTGTAGATTACTCAGAAGCAGAACAGAGTGATGAACAACTTCATCAAGAAATATCTCAGGCTAATGTCATCTGTATAGTGTATGCCGTTAACAACAAGCATTCTATTGATAAGGTAACAAGTCGATGGATTCCTCTCATAAATGAAAGAACAGACAAAGACAGCAG(SEQ ID NO:1),将其命名为hsa_circRNA_102032。

experiment example 2

[0026] Experimental example 2 materials and processing:

[0027] 1) Collection of peripheral blood samples

[0028] Specimens were collected from patients who underwent PLC liver transplantation 1 day before, 1 day after, 3 days after, and 7 days after surgery in the Nephrology Department of the No. For the peripheral blood of healthy volunteers with normal physical examination, 0.5ml of each sample was collected in a 0.5ml cryopreservation tube and stored in a -80°C refrigerator for future use. All research subjects gave informed consent to participate in this experiment, and the process was reviewed and approved by the hospital ethics committee.

[0029] 2) Sample preparation and evaluation

[0030] RNA sample preparation

[0031] In the experiment, patients with liver cancer were divided into 1 day before liver transplantation group, 1 day after operation, 3 days after operation, 7 days after operation group and healthy control group.

[0032] Take 2ml of mixed whole bl...

experiment example 3

[0040] Experimental Example 3 Real-time fluorescent quantitative PCR detection

[0041] Primer design

[0042]According to the comparison between the preoperative group (preoperative 1 day group) and the healthy control group and the postoperative group (postoperative 1 day, 3 day, 7 day group) compared with the preoperative group, or the comparison between the preoperative group and the healthy control group The screening principle of down-regulation and up-regulation in the postoperative group compared with the preoperative group randomly selected verified circRNAs for fluorescence quantitative verification. The fold difference was calculated by 2-ΔΔCt method and detected by RT-PCR. The PCR primer sequences are as follows:

[0043] Table 1 RT-PCR primer list

[0044]

[0045] RT-PCR for verification

[0046] RT-PCR was used for verification. To establish an 8 μL system, add 5 μL of 2×Master Mix, 0.5 μL of forward and reverse primers, and 2 μL of distilled water. Add...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses CircRNA with the sequence shown as SEQ ID NO:1, and further discloses an RT-PCR primer for detecting the CircRNA. The CircRNA has the obvious expression differences before and after the liver cancer operation; the expression quantity at one day before the lung cancer operation is obviously raised through being compared with that in a healthy control group; the obvious reduction trend exists on the 1st day, the 3rd day and the 7th day after the liver transplantation operation. The existing clinic auxiliary diagnosis technology used for the liver cancer is not complete, so that the CircRNA has the potential used as a biomarker relevant to the liver cancer.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular to the application of a novel circular hsa_circRNA_102032. Background technique [0002] The liver is an extremely important metabolic organ in the body, and its dysfunction will affect the body's normal metabolism and changes in the internal environment. Primary liver cancer (PLC) is a type of malignant tumor that occurs in the liver. It usually develops from chronic liver disease or cirrhosis caused by chemical carcinogens or environmental factors. However, the pathogenesis has not yet been elucidated. Pathological diagnosis and treatment methods have certain limitations. Allogeneic liver transplantation is currently the most thorough and effective method for the treatment of PLC, but how to improve the utilization rate of the donor liver and the survival rate of the recipient has always been a problem faced by the medical community. Therefore, there is an urgent need to discover ne...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
Inventor 戴勇眭维国甘晴张捷初国海刘济忠
Owner SHENZHEN DONGDA BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com