Fusion protein of alpha melanocyte-stimulating hormone and its preparation method and application
A technology of fusion protein and melanocytes, which is applied in the field of fusion protein of α-melanocyte-stimulating hormone and its preparation, can solve the problems of inability to achieve stable and high-efficiency expression of α-MSH, many influencing factors, and prolong half-life, so as to achieve the goal of treating brain cancer. Inflammation and related diseases, ensuring biological activity, and prolonging the effect of half-life
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] Construction and expression of the fusion protein yeast expression vector of embodiment 1 pPINKα-HC / PTD-HSA-L-α-MSH and pPINKα-HC / HSA-L-α-MSH
[0058] 1. Construction of pPINKα-HC / PTD-HSA-L-α-MSH vector
[0059] 1. Design PCR primers:
[0060] NFT1: TCTCTCGAGAAAAGGTACGGTAGAAAAGAAACGTAGACAAAAGACGTAGA
[0061] NFT2:GAAAGAAACGTAGACAAAAGACGTAGA GATGCACACAAGAGTGAG
[0062] R2: GCTCCATAGAGTAAGAACCAGATCCACCTCCAGAACCTCCACCTCCTAAGCCTAAGGCAGCTTG
[0063] R1:TTAAATGGCCGGCCGGTACCttaAACTGGCTTACCCCATCTAAAGTGTCCCATAGAGTAAGAAC
[0064] 2. The first round of PCR amplification: pcDNA3.1-HSA plasmid DNA was used as a template, and NFT2 and R2 were used as upstream and downstream primers, respectively, for PCR amplification. The reaction conditions are as follows: ① Denaturation: 94°C, 5min; ② Denaturation: 94°C, 1min; ③ Refolding: 55°C, 30S; ④ Extension: 72°C, 2min; ⑤ Return to step "②" for 35 cycles; ⑥ Extend : 72°C, 5min, the total number of cycles is 30 times. The PCR product was...
Embodiment 2
[0076] Example 2 Verification of PTD-HSA-L-α-MSH crossing the blood-brain barrier function
[0077] Experimental Materials
[0078] 1. Experimental equipment
[0079] Syringe, pipette gun, centrifuge (Hitachi), ultrapure water instrument (Millipore), ultrasonic instrument, constant temperature culture
[0080] Breeding box (Shanghai Yiheng), microplate reader (Thermo), etc. HSA Elisa kit (Cygnus Technologies)
[0081] 2. Experimental animals
[0082] Ten standard weight Kunming mice were purchased from the Experimental Animal Center of Lanzhou University.
[0083] 3. Experimental method
[0084] Grouping and administration of mice:
[0085]Ten Kunming mice were randomly divided into two groups with a body weight of about 18-22 g: 1-control group (injected with HSA-L-α-MSH), 2-alpha melanocyte-stimulating hormone fusion protein group (injected with PTD-HSA -L-α-MSH).
[0086] The control group was injected with tail vein (150uL, 1μm / kg) HSA-L-α-MSH. In the fusion prote...
Embodiment 3
[0091] Example 3 Research on biological activity of PTD-HSA-L-α-MSH
[0092] Experimental Materials
[0093] 1. Experimental equipment
[0094] Syringe, pipette gun, centrifuge (Hitachi), ultrapure water instrument (Millipore), ultrasonic instrument, constant temperature culture
[0095] Breeding box (Shanghai Yiheng), microplate reader (Thermo), etc. TNF-a Elisa Kit (for Daktronics)
[0096] 2. Experimental animals
[0097] Twenty standard weight Kunming mice were purchased from the Experimental Animal Center of Lanzhou University.
[0098] 3. Experimental method
[0099] Grouping and administration of mice:
[0100] Lipopolysaccharide LPS (Lipopolysaccharides) is Gram-negative bacterial endotoxin, which is a component of the cell wall of Gram-negative bacteria. Injecting LPS into the lateral ventricle of mice can cause neurodegeneration and inflammatory reactions in the brain. In this experiment, mouse brain The tumor necrosis factor (tumor necrosis factors a, TNF-a) ...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
molecular weight | aaaaa | aaaaa |
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com