Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of preparation method and application of soluble housefly mdpropo1 recombinant protein

A recombinant protein, soluble technology, applied in the field of genetic engineering, can solve the problems of unknown efficacy and unclear whether MdproPO1 protein has

Active Publication Date: 2020-03-24
UNIV OF JINAN
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, it is not clear whether MdproPO1 protein has the function of being hydrolyzed into active MdPO1 by protease, let alone its specific efficacy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of preparation method and application of soluble housefly mdpropo1 recombinant protein
  • A kind of preparation method and application of soluble housefly mdpropo1 recombinant protein
  • A kind of preparation method and application of soluble housefly mdpropo1 recombinant protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0100] Expression of MdproPO1 recombinase

[0101] The main steps include:

[0102] Use a 1 mL sterile syringe needle to dip in an equal amount of mixed E. coli ( Escherichia coli ) and Staphylococcus aureus ( Staphylococcus aureus ) live bacteria solution (concentration about 3 * 10 8 cfu / mL), in the hind abdomen of the third instar larvae of Housefly stinging housefly, one needle per larva, transferred to fresh medium and reared for 4 h, extracted the total RNA stimulated by housefly reverse transcription into cDNA as a template, and synthesized containing Kpn I and Sal The forward and reverse primers of the I endonuclease site, the primer sequence is:

[0103] mdproPO1 ExF: 5'-TAGatc GGTACC ATGACTGACAAAAAGAATCTCC—3' (SEQ ID NO. 3)

[0104] mdproPO1 ExR: 5'-TAG GTC GAC GCTGGCTGGAGAAAACTTAT - 3' (SEQ ID NO. 4);

[0105] After polymerase chain reaction (PCR), amplified 2055 bp mdproPO1 The ORF of the gene was cloned into pET-30a plasmid (Invitrogen), and ...

Embodiment 2

[0107] Purification, Denaturation and Refolding of MdproPO1 Inclusion Body

[0108] The main steps include:

[0109] ⅰ. Purification of inclusion bodies: Centrifuge the induced bacterium solution with the maximum expression of MdproPO1 at 7000 rpm for 10 min, collect the bacterium, and wash with l × PBS (140 mM NaCl, 2.7 mM KCl, 10 mM NaCl 2 HPO 4 ,1.8 Mm KH 2 PO 4 , pH 7.4), resuspended, ultrasonicated in an ice bath, centrifuged at 12000 rpm for 10 min at 4°C, and the supernatant and precipitate were collected separately. The expressed MdproPO1 recombinant protein was all in the precipitate, which was an inclusion body, and the size was the same as the expected 83.5 kDa match, including mdproPO1 The encoded protein of the 2055 bp ORF of the gene is 79.3 kDa, and the His tag on the vector is about 4.2 kDa ( figure 2 ).

[0110] ⅱ. Denaturation of inclusion bodies: Suspend the MdproPO1 inclusion bodies collected by centrifugation with Buffer A (50 mM Tris-HCl, 5 mM EDT...

Embodiment 3

[0120] Application of MdproPO1 refolding protein

[0121] mainly includes:

[0122]ⅰ. Oxidant: MdproPO1 refolding protein is converted into MdPO1 by heating or activated by chemical reagents such as ethanol. MdPO1 is an oxidizing agent for oxidizing phenolic substances. Therefore, MdproPO1 refolding protein can be developed into an oxidizing agent.

[0123] ⅱ. Melanizing agent: MdproPO1 refolding protein is heated or Ca 2+ Activated by ions to form MdPO1, MdPO1 catalyzes the formation of melanin, therefore, MdproPO1 refolding protein can be developed as a melanizing agent.

[0124] ⅲ. Fly killer and immune agent: Divide housefly larvae into four groups, and do the following treatments respectively: Group 1, no injection; Group 2, inject 0.4 μl (3×10 8 CFU / mL) Escherichia coli; Group 3, first injected 0.4 μl MdproPO1 antiserum, and then injected 0.4 μl Escherichia coli (3×10 8 CFU / mL); in group 4, 0.4 μl of pre-serum was injected first, and 0.4 μl of Escherichia coli (3×10...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a preparation method and application of soluble housefly MdproPO1 recombination protein. The preparation method includes the steps of firstly, building a mdproPO1 / pET-30a recombination expression vector; screening the expression strain mdproPO1 / pET-30a / Rosetta of the high-expression MdproPO1 recombination protein; thirdly, performing fermental cultivation and induced expression of the expression strain; fourthly, performing denaturation and renaturation of MdproPO1 inclusion bodies. The preparation method has the advantages that housefly prophenoloxidase (MdproPO1) produced by an Escherichia coli expression system is high in expression quantity, a large amount of MdproPO1 inclusion bodies can be obtained through prokaryote recycling and crushing, and the soluble MdproPO1 recombination protein with enzymatic activity can be obtained through the denaturation and renaturation of the MdproPO1 inclusion bodies; the MdproPO1 recombination protein can be developed into fly spray, an oxidizing agent, a blackening agent and an immunizing agent and is applicable to multiple fields such as sanitation, healthcare, biology and chemical engineering.

Description

technical field [0001] The invention relates to a preparation method and application of a soluble housefly MdproPO1 recombinant protein, belonging to the technical field of genetic engineering. Background technique [0002] The housefly is a worldwide health pest that can spread hundreds of pathogens such as bacteria, viruses and parasites, but it can survive well by itself, which is entirely due to the housefly's strong innate immune system. [0003] Insects lack acquired immunity and rely entirely on innate immunity to invading pathogens. The innate immunity of insects includes two parts: cellular immunity and humoral immunity. Cellular immunity mainly refers to the encapsulation and phagocytosis of pathogens by blood cells; humoral immunity refers to the production and melanization of antibacterial factors such as antimicrobial peptides. The melanization is accomplished by the prophenoloxidase-activated system (prophenoloxidase-activated system, proPO system). The proP...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/02C12N15/70C12N1/21A01N37/46A01P7/04A61K38/44A61P17/00A61P37/04C12R1/19
CPCA01N37/46A61K38/00C12N9/0059C12N15/70C12N2800/101C12Y110/03001
Inventor 李殿香于洋栾园园王蕾
Owner UNIV OF JINAN
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com