Interferon regulatory factor 6(IRF6) and application of inhibitor of factor in treatment of myocardial hypertrophy
A myocardial hypertrophy and inhibitor technology, applied in the field of gene function and application, can solve problems such as little known function, and achieve the effect of promoting myocardial hypertrophy and worsening heart function.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0054] Example 1 Construction of heart-specific IRF6 knockout mice and IRF6 transgenic mice
[0055] 1. Construction of heart-specific IRF6 gene knockout mice (see the construction strategy figure 1 A)
[0056] Use CRISPR-Cas9 technology to construct heart-specific IRF6 knockout mice. First, use the online CRISPR design tool (http: / / crispr.mit.edu) to design a CRISPR target site in introns 2 and 3 of the mouse IRF6 gene. The target sequences are:
[0057] IRF6-sgRNA 1: GGTCTGGGGCGACATTGTACAGC AGG,
[0058] IRF6-sgRNA 2: GGCGTGTTAGTAAGCCGAAGTCAC AGG.
[0059] In addition, a Donor Vector for homology repair was designed, which includes homology arms on both sides, exon 3 in the middle, and two loxp sequences in the same direction.
[0060] (1) Construction of targeting vector: The two primers corresponding to sgRNA1 and sgRNA2 were respectively fused into double-stranded DNA, and then ligated into the pUC57-sgRNA vector treated with restriction enzyme BsaI with T4 DNA ligase. There is a ...
Embodiment 2
[0084] Example 2 Expression of IRF6 in the heart of normal people and patients with cardiomyopathy
[0085] Select normal human hearts (individuals donated by non-cardiac causes) and recipients replaced by patients with dilated cardiomyopathy patients undergoing heart transplantation), and perform SDS-PAGE-Western Blot experiment (Western Blot) on the protein extracted from the heart, combining specificity Antibodies that recognize IRF6 are detected to determine the expression of IRF6, and GAPDH is used as an internal control. Test results such as image 3 As shown, the expression of IRF6 in the heart of patients with dilated cardiomyopathy is significantly up-regulated.
Embodiment 3
[0086] Example 3 Obtaining a model of myocardial hypertrophy
[0087] 1. Grouping of experimental animals: A model of cardiac hypertrophy was established by aortic coarctation (AB) surgery. Randomly divided into 10 groups, grouped as follows: control group sham operation group (α-MHC-MCM Sham, IRF6-flox Sham) and control group AB operation group (α-MHC-MCMAB, IRF6-flox AB), IRF6 gene knockout Mouse sham operation group (IRF6-CKO Sham) and AB operation group (IRF6-CKOAB), non-transgenic mouse sham operation group (NTG Sham) and AB operation group (NTG AB), heart-specific IRF6 transgenic mouse sham operation Group (TG Sham) and AB operation group (TG AB).
[0088] 2. The myocardial hypertrophy model adopts aortic arch constriction (AB) surgery, the model operation process:
[0089] 2.1 Preoperative preparation
[0090] (1) Anesthesia: Weigh the mice first, calculate the required amount of anesthetic (3% sodium pentobarbital) according to 90mg / kg body weight, inject it through the abdo...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap