Application of Mincle and inhibitor thereof in hepatic ischemia reperfusion injuries
A technology for reperfusion injury and liver ischemia, applied in the field of gene function and application, can solve the problem of inability to activate the Mincle gene, and achieve the effect of worsening liver ischemia-reperfusion injury
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Example 1 Construction of Hepatocyte-specific Mincle Gene Knockout Mice and Mincle Transgenic Mice
[0036] (1) Construction of hepatocyte-specific Mincle gene knockout mice (for the construction strategy, see figure 1 A)
[0037] According to the information of the Mincle gene, CRISPR Design was used to design a CRISPR targeting site in intron 2 and 4 respectively. The target sequences are:
[0038] Mincle-sRNA1: CCTAATGATAGTGGTCTGAG AGG;
[0039] Mincle-sRNA2: TGAGGGCAAACATCTAATAC AGG.
[0040] In addition, a donor vector (Donor Vector) for homology repair was designed, which included homology arms on both sides, exons 3 and 4 in the middle, and two loxp sequences in the same direction.
[0041] 1) Construction of targeting vector: The two primers corresponding to sgRNA1 and sgRNA2 were fused into double-stranded DNA, and then ligated into pUC57-sgRNA (Addgene 51132) vector treated with restriction endonuclease BsaI with T4 DNA ligase. There is a T7 promoter upst...
Embodiment 2
[0062] Example 2 Obtaining of mouse liver ischemia-reperfusion injury model (ischemia / reperfusion injury, I / R)
[0063] (1) Grouping of experimental animals: male C57BL / 6 strain wild-type mice, hepatocyte-specific Mincle gene knockout mice, Mincle transgenic mice, and non-transgenic mice. Perfusion (I / R) model. They were randomly divided into 8 groups: C57BL / 6J strain wild-type mice sham operation group (WT Sham) and I / R operation group (WT I / R), Mincle gene knockout mouse sham operation group (KO Sham) and I / R operation group. R operation group (KO I / R), non-transgenic mouse sham operation group (NTG Sham) and I / R operation group (NTG I / R), liver cell-specific Mincle transgenic mouse sham operation group (TG Sham) and I / R surgery group (TG I / R).
[0064] (2) I / R model operation of liver ischemia / reperfusion injury (using non-invasive vascular clips to clamp the portal vein and hepatic artery in the middle lobe and left lobe, so that about 70% of the liver ischemia) operatio...
Embodiment 3
[0070] The measurement of embodiment 3 hepatic necrosis area and liver function index (AST, ALT)
[0071] The evaluation indicators of the severity of liver ischemia-reperfusion injury mainly include the area of liver necrosis and liver function indicators (AST, ALT), all of which are positively correlated with the severity of liver ischemia-reperfusion injury.
[0072] (1) Take materials
[0073] Mice in the sham operation group (Sham) and the ischemia / reperfusion group were collected at 1 h, 3 h, 6 h, and 24 h after operation, and sacrificed by cervical dislocation, and 1 mL of blood was collected from the inferior vena cava immediately, and the serum was separated. At the same time, the left lobe of the liver in the ischemic area with a size of about 1.5cm×1cm×0.2cm was fixed in 10% neutral formalin for 24 hours, dehydrated, embedded, paraffin-sectioned, and HE stained.
[0074] Separation of serum: the EP tube where the blood was collected was left at room temperature f...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com