Anti-herbicide and anti-pest fusion gene, encoded protein thereof, and application of encoding protein
A herbicide-resistant, fusion gene technology, used in applications, fusion peptides, genetic engineering, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Embodiment 1 Construction of herbicide-resistant insect-resistant fusion protein expression vector
[0027] The fusion gene formed by the fusion of the glufosinate-ammonium-resistant gene bar and the insect-resistant gene Vip3A is named bar-Vip3A gene, and the encoded protein polypeptide sequence is shown in SEQ ID NO:3. The fusion gene formed by the fusion of the glyphosate-resistant gene Gat and the insect-resistant gene Cry1Ab is named Gat-Cry1Ab gene, and the encoded protein polypeptide sequence is shown in SEQ ID NO:4.
[0028] The bar-Vip3A (SEQ ID NO: 1) gene and the Gat-Cry1Ab (SEQ ID NO: 2) gene are both artificially synthesized, and both have a BamHI restriction site at the 5' end, and both are added at the 3' end A synthetic terminator and a KpnI restriction site were set.
[0029] pUBI is a maize ubiquitin promoter obtained by PCR. PCR primers pUBI-F (5'GAAGCTTGCATGCCTACAGTGCAGCGTGACCC) and pUBI-R (5'GGGTGGATCCTCTAGAGTCGACCTGCAGAAGTAAC) were designed, and ...
Embodiment 2
[0035] Embodiment 2, transformation of rice
[0036] The method of obtaining transgenic rice is to adopt the existing technology (Lu Xiongbin, Gong Zuxun (1998) Life Science 10: 125-131; Liu Fan et al. (2003) Molecular Plant Breeding 1: 108-115). The mature and plump seeds of "Xiushui-134" were dehulled, and callus was induced as transformation materials. The Agrobacterium plates of the vectors pCambia1300-pUBI-bar-Vip3A-p35S-1174 and pCambia1300-pUBI-Gat-Cry1Ab-p35S-1174 constructed in Example 1 were respectively taken. Pick a single colony to inoculate and prepare Agrobacterium for transformation. Put the callus to be transformed into the Agrobacterium bacterium solution with an OD of about 0.6 (preparation of the Agrobacterium bacterium solution: inoculate the Agrobacterium into the medium, and cultivate it at 28°C until the OD is about 0.6; the composition of the medium: 3g / L K 2 HPO 4 , 1g / LNaH 2 PO 4 , 1g / LNH 4 Cl, 0.3g / L MgSO 4 ·7H 2 O, 0.15g / L KCl, 0.01g / L Ca...
Embodiment 3
[0037] Embodiment 3, fusion protein transgenic rice can resist herbicides
[0038] The T0 generation plants of the transgenic rice plants prepared by the method in Example 2 were transplanted into the greenhouse, and the herbicide resistance of the transgenic rice plants and the non-transgenic recipient control plant "Xiu Shui-134" were compared and analyzed. We obtained 86 transgenic lines (named BV) transfected with pCambia1300-pUBI-bar-Vip3A–p35S-1174 vectors for different concentrations of glufosinate-ammonium resistance tests, and the resistance effects are shown in Table 1:
[0039] Table 1*:
[0040] 1x 2x 3x Number of resistant transformation events 65 52 30
[0041]*Note: Table 1 shows the resistance test of rice plants sprayed with different concentrations of glufosinate-ammonium 15 days after sowing. 10 days after spraying glufosinate-ammonium, the plants with no significant difference in plant height, number of leaves and growth vigor com...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap