Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

S-adenosylmethionine synthetase preparation, its preparation method and use

A technology of glutamate dehydrogenase and adenosine isotype, applied in the field of biochemistry, can solve problems such as poor stability and interference

Active Publication Date: 2021-01-26
BEIJING STRONG BIOTECH INC
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] However, the defect of cystathionine cycle enzyme method is that it is easily interfered by human endogenous cystathionine
The cycle enzymatic method of methyltransferase and hydrolase is not interfered by human endogenous cystathionine, but there are still disadvantages such as poor stability

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • S-adenosylmethionine synthetase preparation, its preparation method and use
  • S-adenosylmethionine synthetase preparation, its preparation method and use
  • S-adenosylmethionine synthetase preparation, its preparation method and use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] Example 1: Provide target sequence

[0068] According to the nucleotide sequence of S-adenosylmethionine synthetase published on the NCBI website (Genbank accession number is CP007391.1) is shown in SEQ ID NO:2.

[0069] Design primers, use the Escherichia coli genome as a template, and amplify the gene fragment of S-adenosylmethionine synthetase by PCR;

[0070] The PCR reaction system is as follows:

[0071] wxya 2 O 35μl; 10×Buffer 5μl; dNTP 2μl; template DNA 2μl; forward primer 2.5μl; reverse primer 2.5μl; Taq enzyme 1μl;

[0072] The PCR reaction conditions are as follows:

[0073] 94°C for 3.5min; 94°C for 40s, 55°C for 40s, 72°C for 70s, a total of 35 cycles; 72°C for 10min; 4°C for maintenance;

[0074] Primer sequence:

[0075] Forward: GGGAATTCCATATGATGGCAAAACACCTTTTTAC (SEQ ID No. 3);

[0076] Reverse: ATCCGCTCGAGCTTCAGACCGGCAGCATCGC (SEQ ID No. 4).

[0077] Take the PCR product, and after 1% agarose gel electrophoresis, a product band can be seen at 1...

Embodiment 2

[0079] Embodiment 2: Construction of expression vector

[0080] The PCR product recovered in Example 1 was subjected to double enzyme digestion with NdeI and XhoI enzymes (purchased from New England Biolabs);

[0081] The vector plasmid pET41a (Novagen) was subjected to the same double enzyme digestion treatment;

[0082] The digested plasmid and gene were ligated overnight at 16°C;

[0083] Transform Escherichia coli DH5α the next day, and apply Kan (kanamycin, 50mg / L) resistant LB plates for screening;

[0084] The positive clones obtained by screening were extracted and sequenced after extraction of plasmids, and the plasmids with correct sequencing results were stored for later use.

Embodiment 3

[0085] Embodiment 3: transformation Escherichia coli BL21 (DE3)

[0086] The plasmid constructed in Example 2 was mixed with chemically competent cells BL21(DE3) (purchased from Invitrogen) and then kept in an ice bath for 20 minutes; heat-shocked at 42°C for 90 seconds; quickly added to SOC medium (purchased from Invitrogen), and incubated at 37°C for 1 Paint the panels after hours.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
chromatographic purityaaaaaaaaaa
Login to View More

Abstract

This application relates to S-adenosylmethionine synthetase preparation, its preparation method and use. The preparation method of the present disclosure uses genetic engineering technology to construct the S-adenosylmethionine synthetase gene into a prokaryotic expression vector, and transforms Escherichia coli to construct a recombinant host cell; obtains high-yield bacterial cells through fed-batch fermentation; Afterwards, the S-adenosylmethionine synthetase is purified by affinity chromatography, and the chromatographic purity of the obtained protein is above 90%. The present application also relates to the use of S-adenosylmethionine synthetase in the preparation of homocysteine ​​diagnostic reagents.

Description

technical field [0001] The present disclosure relates to the field of biochemistry; in particular, it relates to an S-adenosylmethionine synthetase enzyme preparation and its production method and use. Background technique [0002] S-adenosylmethionine synthetase (hereinafter referred to as MAT) (EC 2.5.1.6) is a very important enzyme in organisms. in the presence of Mg 2+ and K + When present, it catalyzes the reaction of L-Met with ATP to generate S-adenosylmethionine (SAM). SAM is an important intermediate metabolite in organisms and participates in various biochemical reactions in vivo. S-adenosylmethionine synthetase is an important raw material enzyme. [0003] The existing methods for producing S-adenosylmethionine synthase mainly use yeast systems (see 1-4), including Pichia pastoris and Saccharomyces cerevisiae. The disadvantage of this method is mainly that the production process is more complicated than the prokaryotic expression system, the yield is low, and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/10C12N15/54C12N15/70C12Q1/48C12Q1/32C12Q1/34
CPCC12N9/1085C12Q1/32C12Q1/34C12Q1/48C12Y205/01006
Inventor 龚俊高长文高秋峰刘希
Owner BEIJING STRONG BIOTECH INC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com