An attenuated strain of Salmonella choleraesuis and its preparation method and application
A technology for Salmonella cholerae and poisonous pigs, which is applied in the field of attenuated Salmonella choleraesuis and its preparation, can solve problems such as not being very clear, and achieve the effect of excellent attenuating effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] 1. Primer design (for the construction and identification of mutant strains)
[0041] Referring to the whole genome sequence of Salmonella choleraesuis SC-67, two pairs of primers were designed to delete the wzx gene (Dwzx-1F / DwbaD-1R, Dwzx-2F / Dwzx-2R). The upstream and downstream fragments of wzx gene: up-wzx (upper homologous arm) and down-wzx (lower homologous arm) were amplified from Salmonella choleraesuis C3545 respectively, and the sizes of the amplified fragments were 346bp and 333bp respectively.
[0042] Dwzx-1F: CCGCTGATGGAAGTGCGAACG
[0043] Dwzx-1R: ggttaacttattttactttccggatgtaaac
[0044] Dwzx-2F: gtaaaataagttaaccaagcgggaaaatatc
[0045] Dwzx-2R: GATTCAACAAACTCTTTCACCG
[0046] 2. Construction of the C3545wzx mutant strain of Salmonella choleraesuis
[0047] Using the extracted Salmonella choleraesuis C3545 genome as a template, primers Dwzx-1F / Dwzx-1R and Dwzx-2F / Dwzx-2R were used to amplify the upstream and downstream homology arms of the wzx gene, res...
experiment example 1
[0053] Phenotypic Characterization of Experimental Example 1 Gene Deletion Strain
[0054] We will compare and observe the lipopolysaccharides of the strain obtained in Example 1 and the wild strain, which are important immunogens or virulence factors of Salmonella choleraesuis.
[0055] Lipopolysaccharide extraction and silver staining observation: extract a small amount of LPS for silver staining observation, the specific steps are: take 2-3mL each of the bacterial strain obtained in Example 1 and the wild strain cultivated overnight, centrifuge at 1,2000×g for 1min, Collect the cells; wash the cells with PBS or ultrapure water 2 to 3 times; take 150 μL lysis buffer (1 mL 0.5M Tris-cl pH=6.8, 0.8 mL glycerol, 1.6 mL 10% SDS, 0.4 mL β-mercaptoethanol, 4.2 mL Ultrapure water), mix the cells and cook in boiling water for 10 minutes; cool the sample to room temperature, centrifuge at 1,2000×g, 4°C for 10 minutes; take 10 μL of the supernatant and add it to 90 μL loading buffer (...
experiment example 2
[0057] Experimental example 2 Determination of attenuation effect of Salmonella choleraesuis wzx gene deletion strain
[0058] In order to determine the attenuation effect of the constructed gene deletion strain C3545Δwzx, the virulence changes of the gene deletion strain and the parental strain on mice were compared by oral administration. In this experiment, six-week-old BALB / c female mice were purchased, fed for one week to adapt to the environment, and then challenged by oral routes. There were 3 mice in each group, a total of eight groups, of which six groups were mutant strains, one group was a blank group that took BSG orally, and one group was oral administration of BSG. It is the positive control group of oral wild strain C3545. Oral dose of mutant strain was 1×10 8 CFU and 1×10 9 CFU, the oral dose of the positive control group was 1×10 5 CFU and 1×10 6 CFU. After the challenge, the mice were fed for 4 weeks, and their growth status was observed and recorded eve...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com