Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of multigene recombinant chimeric antigen receptor molecule

A chimeric antigen receptor, multi-gene technology, applied in the field of molecular biology, to achieve the effect of prolonging the viability

Active Publication Date: 2019-08-23
南通睿科医药科技有限公司
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The therapeutic effect of CAR-T cells on other solid tumors is significantly lower than that of "anti-CD19 monoclonal antibody-CAR-T" cells on acute and chronic lymphocytic leukemia

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of multigene recombinant chimeric antigen receptor molecule
  • A kind of multigene recombinant chimeric antigen receptor molecule
  • A kind of multigene recombinant chimeric antigen receptor molecule

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1 Construction of Common CAR Structure Transmembrane and Intracellular Signal Peptide Fragments

[0042] The gene carrier is the eukaryotic fluorescent expression plasmid pIres2-EGFP. Select CD28 transmembrane and intracellular fragments (UniProtKB: P10747-1, 340nt-660nt) and CD3zeta fragments (UniProtKB: P20963-1, 154nt-495nt), and design 5'BglII and 3'SalI restriction sites at both ends, Among them, the CD28 intracellular co-stimulatory sequence AGGCTCCTG was changed to CGCGGAGGA according to literature records (Blood. 2003; 102:4320-4325), and the encoded amino acid was changed from double leucine to double glycine. The sequence is marked as 28ZT, and the sequence is as follows:

[0043] AGATCT ATTGAAGTTATGTATCCTCCTCCTTACCTAGACAATGAGAAGAGCAATGGAACCATTATCCATGTGAAAGGGAAACACCTTTGTCCAAGTCCCCTATTTCCCGGACCTTCTAAGCCCTTTTGGGTGCTGGTGGTGGTTGGTGGAGTCCTGGCTTGCTATAGCTTGCTAGTAACAGTGGCCTTTATTATTTTCTGGGTGAGGAGTAAGAGGAGCCGCGGAGGACACAGTGACTACATGAACATGACTCCCCGCCGCCCCGGGCCCAC...

Embodiment 2

[0045] Example 2 Construction of PD-1 (PDCD1) transmembrane and intracellular signal peptide fragments

[0046] Starting from the 5' end Bgl II, design a Kozak sequence (GCCACC), the start codon ATG and the nucleic acid sequence encoding a connecting peptide of 15 amino acids. The 3'downstream of the connecting peptide nucleic acid sequence is sequentially connected: PD-1 (UniProtKB: Q15116, 61nt-588nt), CD28 (UniProtKB: P10747-1, 538nt-660nt), CD3zeta (UniProtKB: P20963-1, 154nt-495nt), and finally is the sequence of the Sal I restriction site. The sequence is marked as PD-1-28ZT, and the sequence is as follows:

[0047] AGATCTGCCACCATGGGTGGCGGTGGCTCGGGCGGTGGTGGCTCCGGCGGTGGCGGTTCGCCAGGATGGTTCTTAGACTCCCCAGACAGGCCCTGGAACCCCCCCACCTTCTCCCCAGCCCTGCTCGTGGTGACCGAAGGGGACAACGCCACCTTCACCTGCAGCTTCTCCAACACATCGGAGAGCTTCGTGCTAAACTGGTACCGCATGAGCCCCAGCAACCAGACGGACAAGCTGGCCGCCTTCCCCGAGGACCGCAGCCAGCCCGGCCAGGACTGCCGCTTCCGTGTCACACAACTGCCCAACGGGCGTGACTTCCACATGAGCGTGGTCAGGGCCCGGCGCAATGACAGCGGCA...

Embodiment 3

[0049] Example 3 Construction of PD-L1 transmembrane and intracellular signal peptide fragments

[0050] Starting from the 5' end Bgl II, design a Kozak sequence (GCCACC), the start codon ATG and the nucleic acid sequence encoding a connecting peptide of 15 amino acids. The 3'downstream of the connecting peptide nucleic acid sequence is sequentially connected: PD-L1 (UniProtKB: Q9NZQ7, 55nt-792nt), CD28 (UniProtKB: P10747-1, 538nt-660nt), CD3zeta (UniProtKB: P20963-1, 154nt-495nt), and finally is the sequence of the Sal I restriction site. The sequence is marked as PD-L1-28ZT, and the sequence is as follows:

[0051] AGATCT GCCACCATGGGTGGCGGTGGCTCGGGCGGTGGTGGCTCCGGCGGTGGCGGTTCGTTTACTGTCACGGTTCCCAAGGACCTATATGTGGTAGAGTATGGTAGCAATATGACAATTGAATGCAAATTCCCAGTAGAAAAACAATTAGACCTGGCTGCACTAATTGTCTATTGGGAAATGGAGGATAAGAACATTATTCAATTTGTGCATGGAGAGGAAGACCTGAAGGTTCAGCATAGTAGCTACAGACAGAGGGCCCGGCTGTTGAAGGACCAGCTCTCCCTGGGAAATGCTGCACTTCAGATCACAGATGTGAAATTGCAGGATGCAGGGGTGTACCGCTGCATGATCAGCTATGG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to the field of molecular biology and particularly relates to a multi-gene recombination chimeric antigen receptor molecule which comprises: 1) extracellular-region and transmembrane-region structure domains of two peptide fragments connected through a connection peptide and combined with an immunosuppressive molecule on the tumor cell surface and / or tumor matrix cell surface; and 2) the intracellular domain peptide fragment of a co-stimulatory signal molecule. The multi-gene recombination chimeric antigen receptor molecule provided by the invention has specificities of complete expression, recognition maintaining and combination function and also has the functions of activating T cells and can enhance the survival ability.

Description

technical field [0001] The invention relates to the field of molecular biology, in particular to a multigene recombinant chimeric antigen receptor molecule. Background technique [0002] Malignant tumor is a disease that seriously threatens human life. The pathogenesis of malignant tumors or cancers is diverse, and their common manifestation is that mutated tumor cells are not cleared by the body's immune system, can multiply and spread without limit, and destroy normal cells and functions of surrounding tissues. For a long time, the medical community has made a lot of efforts in trying to cure and control the course of tumor diseases, but with little success. At present, in the treatment of malignant tumors, in addition to eradication surgery, the clinical adjuvant treatment methods in the mainstream medical field are still radiation therapy, chemotherapy and antibody therapy. Existing treatments are almost ineffective against tumor recurrence. [0003] In 1985, American...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/63
CPCC07K14/47C07K14/4748C07K2319/02C07K2319/03
Inventor 郝晓勇黄招琴
Owner 南通睿科医药科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com