Functional analysis and application of verticillium dahliae pathogenicity-related gene VdGFP
A disease-related gene, Verticillium dahliae technology, applied in the field of plant pathology research, can solve the problems of different functions of homologous genes, different biological characteristics and genetic backgrounds, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0014] 1. The construction of the knockout vector and the complementation vector of the VdGFP gene, and the constructed vector was introduced into the Agrobacterium AGL-1 strain by the chemical transformation method, and the AGL-1 with the knockout function and complementation function of the VdGFP gene were obtained respectively One for each Agrobacterium, the specific process is described as follows:
[0015] A. Use the biological information resources shared online (see: http: / / www.broadinstitute.org / annotation / genome / verticillium_dahliae / MultiHome.html), respectively design two pairs of nucleic acid primers, that is, the upstream of the 5′ flank amplification primer: GGGGACAGCTTTCTTGTACAAAGTGGAATCGGAACTGTGCGATGATGT ; Downstream of the 5' flanking amplification primer: GGGGACTGCTTTTTTGTACAAACTTGTGTGGAGGCTGGTCGTGTCTT; Upstream of the 3' flanking amplification primer: GGGGACAACTTTGTATAGAAAAGTTGTTCCGCCTTTGTCATCCCTCTTC; Downstream of the 3' flanking amplification primer: GGGGACA...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com