A molecular marker and its application for assisted selection of mung bean resistance gene br3
A technology of molecular markers and assisted selection, which is applied in the field of crop genetics and breeding, can solve complicated problems, and achieve the effect of eliminating time-consuming and labor-intensive identification of soybean resistance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1 Determination of SYD404 Molecular Marker
[0032] Experimental Materials:
[0033] Jilu 7, which is sensitive to bean elephant, was used as the female parent, and the mung bean variety was bred by the Institute of Grain and Oil Crops, Hebei Academy of Agriculture and Forestry Sciences; Cross Jilu 7 and V1128, and harvest F 1 generation. will come from the same F 1 The seeds of a single plant propagate into F2 A total of 158 F 2 single plant. At the same time the F 1 A single plant was backcrossed with the recurrent parent Jilv 7 and obtained 105 BC 1 single plant. f 2 Randomly take 30 seedlings to plant and get F 2:3 family lineage.
[0034] Anti-soybean identification method:
[0035] For parents, F 1 , F 2 and BC 1 and F 2:3 The pedigree was identified for resistance to bean weevil. Each single plant randomly gets 90 seeds, divides into 3 repetitions, each repeats 30 seeds, puts them in diameter 5cm, high 2.5cm small plastic box (without cove...
Embodiment 2
[0049] Example 2 Verification of Molecular Markers
[0050] In order to verify the selection effect of the molecular marker SYD404 in actual breeding, according to the identification results of the resistance to C. 8 From the population of recombinant inbred lines (RILs), 20 lines resistant to and susceptible to Elephant leguminosa were randomly selected, and SSR primers (upstream primer: 5ˊACGGCTATTCATCGTTTTGC3ˊ; downstream primer: 5ˊCAACCCGAAGCCAAAAACTA 3ˊ) were used for PCR amplification verification, respectively. The sensitive parent Jilu 7 (without resistance gene) and the resistant parent V1128 (with resistance gene Br3) were used as controls.
[0051] The PCR reaction system is 10μL, containing 1×PCR buffer, 0.2mM dNTPs, 0.2μM upstream and downstream primers, 20ng Jilv 7×V1128F 8 Generation strain genomic DNA, 0.5U Taq enzyme;
[0052] PCR amplification program: pre-denaturation at 95°C for 5 min, and then each cycle: denaturation at 95°C for 30 s, annealing at 55°C ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap