Chimeric antigen receptors and their genes and recombinant expression vectors, engineered her1-targeted nkt cells and their applications
A chimeric antigen receptor and NKT cell technology is applied in the field of tumor biological products to achieve the effect of enhancing specific killing activity, enhancing ability, and good industrial application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0026] The preparation method of the lentiviral expression vector pWPT-HER1ScFv-CD8-CD137-CD3ζ is not particularly limited, and can be various methods that can be imagined by those skilled in the art. Preferably, the lentiviral expression vector pWPT-HER1ScFv-CD8-CD137 -The preparation method of CD3ζ comprises the following steps:
[0027] (1) The hinge region and transmembrane region of CD8, the intracellular signaling domain of CD137 and the intracellular signaling domain of CD3ζ were respectively amplified from NKT cell cDNA, and cloned into the vector pWPT-GFP to construct pWPT-CD8 - CD137-CD3ζ;
[0028] (2) Synthesize the nucleotide sequence encoding the signal peptide of rat growth hormone and HER1ScFv, clone it into pWPT-CD8-CD137-CD3ζ, and obtain the correct sequence of pWPT-HER1ScFv-CD8-CD137-CD3ζ after sequencing verification.
[0029] In step (1), there is no particular limitation on the methods for respectively amplifying the hinge region and transmembrane region ...
Embodiment 1
[0063] Example 1 Preparation of NKT cells
[0064] (1) Take human venous blood in a vacuum tube containing heparin. Mononuclear cells (PBMCs) were obtained by density gradient centrifugation using lymphocyte separation medium.
[0065] (2) After the PBMCs were washed three times, the final cell concentration was adjusted to 2×10 by using NKT cell culture medium GT-T551 containing 0.6% by volume of fetal bovine serum. 6 cells / mL; the cells were inoculated in a 75cm 2 in cell culture flasks. Then add recombinant human protein interferon-γ with a final concentration of 1000U / mL and recombinant human interleukin-2 with a final concentration of 1000U / mL in the culture medium, and incubate at 37°C with a saturated humidity of 5% CO 2 cultured in an incubator.
[0066] (3) On the fourth day, 100 mL of NKT cell culture medium GT-T551 containing 0.6 vol% fetal bovine serum was added to the culture flask, and recombinant human interleukin 2 with a final concentration of 1000 U / mL wa...
Embodiment 2
[0067] Example 2 Construction of lentiviral expression vector pWPT-HER1ScFv-CD8-CD137-CD3ζ
[0068] (1) Preparation of NKT cell cDNA
[0069]The NKT cells cultured in Example 1 were centrifuged to precipitate, and the total RNA of the cells was extracted with RNAiso Reagent, a total RNA extraction kit, and stored at -80°C for future use. Extracted total RNA with RevertAid Reverse Transcription Kit TM NKT cell cDNA was obtained by reverse transcription with the First StrandcDNA Synthesis Kit, and stored at -20°C for future use.
[0070] (2) Preparation of lentiviral plasmid pWPT-CD8-CD137-CD3ζ
[0071] The following primer sequences were designed and synthesized (wherein, the underline marks are protected bases, and the square boxes are enzyme cleavage sites):
[0072] P1 (SEQ ID NO.11): GATC CTGAGCAACTCCATCATGTACTTC
[0073] MluI
[0074] P2 (SEQ ID NO.12): GATC GCAGTAAAGGGTGATAACCAGTGA
[0075] BglII
[0076] P3 (SEQ ID NO.13): GATC AAACGGGGCAGAAAGAAACTCC ...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap