Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Rice granule shape gene qSS7 as well as preparation method and application

A rice grain and gene technology, applied in the field of plant genetic engineering, can solve the problems of unpublished articles, shorten the breeding process and improve the accuracy

Active Publication Date: 2015-07-01
HUAZHONG AGRI UNIV
View PDF2 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] This invention has not been reported at home and abroad. Although the research group has published the fine positioning results of the gene, it has not published articles related to the content of the invention. The invention is unknown to the public at home and abroad.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice granule shape gene qSS7 as well as preparation method and application
  • Rice granule shape gene qSS7 as well as preparation method and application
  • Rice granule shape gene qSS7 as well as preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Preparation method of gene qSS7:

[0053] (1) Extract the DNA of Cypress (from the International Rice Research Institute, number: IRGC117282), and use primer qs2 (left primer: ATATCATACTTATATGGCA, right primer: GACAAGTGGCTATGCTGTAT) to perform polymerase chain reaction (PCR), PCR program: 94 ° C Pre-denaturation for 5 minutes; 35 cycles (denaturation at 94°C for 40 seconds; annealing at 55°C for 40 seconds; extension at 72°C for 8 minutes), and extension at 72°C for 10 minutes; the full-length sequence of the Cypress gene was obtained by sequencing the amplified product. The sequence is Shown in SEQ ID NO.1.

[0054] (2) RNA was extracted from young panicle tissue of Cypress, and cDNA was obtained by reverse transcription. Using Cypress young ear cDNA as a template, polymerase chain reaction (PCR) was carried out with primer qs3 (left primer: AAAGGATCCATGCCTCCGGCGAGGGTGCT, right primer: AAAGGATCCTCAGCTTGTACTACTAAATG), PCR program: 94°C pre-denaturation for 5 minutes; 3...

Embodiment 2

[0057] Construction of qSS7 suppression expression vector and establishment of transformed Agrobacterium:

[0058] (1) Design markers according to the sequence of the 3' end of the japonica rice qSS7 cDNA sequence, and add BamHI, KpnI, SacI and SpeI restriction sites at the 5' end of the sequence respectively, and design the sequence of the left primer GL260MF as

[0059] AAAGAGCTCGGATCCGTTGAGGATCCACTGAATGG, the right primer GL260MR sequence is AAAACTAGTGGTACCGTGTAGTTGCTAAGCTTCCTA (primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd.). Polymerase chain reaction (PCR) was carried out using Cypress young ear cDNA as template. The PCR reaction program was pre-denaturation at 94°C for 5 minutes; 35 cycles (denaturation at 94°C for 30 seconds; annealing at 55°C for 30 seconds; extension at 72°C for 40 seconds), and extension at 72°C for 7 minutes to obtain the target fragment.

[0060] Ligate the fragment to the vector. The method is: perform double digestion with ...

Embodiment 3

[0064] Agrobacterium-mediated genetic transformation of indica rice:

[0065] (1) Induction:

[0066] The seeds of mature rice material Q043 (long-grained rice material, chromosome segment substitution line containing qSS7 segment (Qiu et al., 2012)) were dehulled, and then treated with 70% ethanol by volume for 1 minute, 0.15 % concentration of mercuric chloride (HgCl 2 ) Disinfect the surface of the seeds for 15 minutes; wash the seeds 4-5 times with sterilized water; place the seeds on the indica induction medium; culture the inoculated medium in a dark place for 4 weeks at a temperature of 25±1°C.

[0067] (2) Succession:

[0068] Select bright yellow, compact and relatively dry embryogenic calli, and place them on an indica subculture medium for 2-3 weeks in the dark at a temperature of 25±1°C.

[0069] (3) Pre-cultivation:

[0070] Select compact and relatively dry embryogenic calli, put them on the indica rice pre-medium and cultivate them in the dark for 3-4 days a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a rice granule shape gene qSS7 as well as a preparation method and application. The sequence of the rice granule shape gene qSS7 is as shown in SEQIDNO.1. Due to the gene, the granule length and the length to width ratio can be increased, the granule width can be reduced, and the chalkiness rate and the chalkiness degree can be also reduced; and when the appearance quality of rice is improved by using the gene, the quality and the yield of rice can be prevented from negative influence; a gene mark is also designed for qSS7, long and short granule allele can be identified in the seedling period, unexpected heterozygous and pure short granule genotype plants can be rejected, the possibility that descendant granule shapes can be separated when being bred is avoided, and breeding procedures for a next season can be reduced. Therefore, the area of a descendant bred material can be reduced by 75% in quality breeding practice, the gene selection accuracy can be improved, and the breeding progress can be accelerated.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering. More specifically, it relates to a rice grain type gene qSS7, and also relates to a preparation method of the rice grain type gene qSS7, and also relates to a use of the rice grain type gene qSS7, specifically including a main gene qSS7 for controlling grain type, Design molecular marker QS1 for this gene, and use molecular marker technology to introduce a rice long-grain allele into short-grain varieties, so as to make the grains of short-grain varieties longer, improve the appearance and quality of rice, and create new materials for quality improvement. Background technique [0002] Rice is one of the most important food crops in the world. In order to meet the growing population's demand for food, breeders have always regarded increasing the yield per unit area as the main direction of rice breeding, while ignoring the improvement of rice quality. With the improvement of pe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/84
Inventor 余四斌邱先进王记林孙文强
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com