Microsporidium molecule universal detection primers and kit thereof
A technology for microsporidia and general detection, which is applied in the determination/inspection of microorganisms, recombinant DNA technology, biochemical equipment and methods, etc. It can solve the problems of unsatisfactory sensitivity, few primers and low sensitivity, and achieve a wide range of applications , good detection sensitivity, and the effect of increasing the range
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Example 1 Microsporidia Bombyx mori HMG 1 Gene
[0044] 1. According to the method of gene homologous cloning in the gene cloning technology of molecular biology, No. silkworm was cloned and obtained HMG 1 Gene cDNA and full-length DNA sequences.
[0045] 2. Obtaining the full length of cDNA, the specific method is as follows:
[0046] (1) Using Primer premier 5.0 software, combined with comprehensive analysis, the primers primers HMG1F / HMG1R were designed, and the sequences are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.
[0047] Upstream primer HMG1F (SEQ ID NO.3):
[0048] 5' ATGACTGCTCAAAAAGACGATAC 3'
[0049] Downstream primer HMG1R (SEQ ID NO.4):
[0050] 5'TTATTCATCACTATTCTCCTACTTCT 3'.
[0051] (2) Using the purified spore DNA of N.b. silkworm (N.b) as a template, PCR amplification was performed with primers HMG1F / HMG1R.
[0052] (3) The PCR product was purified, connected to pMD19T, and transformed into E.coli DH-5α for culture.
[0053] (...
Embodiment 2
[0057] Example 2 Detection primer design and establishment of PCR amplification method
[0058] 1. Primer design
[0059] Bombyx mori HMG 1 On the basis of genes, multiple pairs of primers were designed by using Primer premier 5.0 software. Through a large number of drug resistance, specificity and sensitivity tests, three pairs of primers were finally selected as representative primer sets. The primer sequences of each set are as follows:
[0060] (1) The first pair:
[0061] Upstream primer HMG1F (SEQ ID NO.3):
[0062] 5' ATGACTGCTCAAAAAGACGATAC 3'
[0063] Downstream primer HMG1R (SEQ ID NO.4):
[0064] 5'TTATTCATCACTATTCTCCTACTTCT 3'.
[0065] (2) The second pair:
[0066] Upstream primer HMG1-sF (SEQ ID NO.5):
[0067] TTCCGAAATAATCTTCTTTTAATTG
[0068] Downstream primer HMG1-sR (SEQ ID NO.6):
[0069] TTGTGCACCGAATCGTAAATAG
[0070] (3) The third pair:
[0071] Upstream primer HMG1-xF (SEQ ID NO.7):
[0072] TCCCTAGGAACTTTTAAAGAGAAG
[0073] Downstream...
Embodiment 3
[0096] Example 3 Primer Specific Detection
[0097] 1. Using the DNA of No. silkworm (N.b), No. tussah mori (N.a), and No. corn borer (N.f) as templates, primers HMG1F / HMG1R, HMG1-sF / HMG1-sR, HMG1-xF / HMG1-xR, carry out PCR amplification with the method of embodiment 2, agarose gel electrophoresis detection result after amplification is finished.
[0098] 2. The amplification results of the three pairs of primers are shown in the attached Figure 4~6 shown. The results showed that both the primers HMG1F / HMG1R and the primers HMG1-xF / HMG1-xR could detect a variety of microsporidia, and had good universal detection ability. However, the primers HMG1-sF / HMG1-sR can only specifically detect N.
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com