Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Microsporidium molecule universal detection primers and kit thereof

A technology for microsporidia and general detection, which is applied in the determination/inspection of microorganisms, recombinant DNA technology, biochemical equipment and methods, etc. It can solve the problems of unsatisfactory sensitivity, few primers and low sensitivity, and achieve a wide range of applications , good detection sensitivity, and the effect of increasing the range

Active Publication Date: 2015-04-08
SOUTH CHINA AGRI UNIV
View PDF3 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Most of the target genes designed for the PCR detection technology of silkworm microsporidia are SSU rRNA, and the primers designed for other microsporidian genes are less or have poor sensitivity, so they are rarely reported
Baker et al (1995) and Terry et al (1999) designed PCR primer V1f / 530r based on the highly conserved region of SSU rRNA of similar species of Microsporidia, which can identify DNA templates of various species of Microsporidia and amplify about 450bp Specific purpose bands, but the sensitivity is unsatisfactory, and the inventors found that when using this primer to detect silkworm egg Microsporidia, the detection sensitivity is extremely low, suggesting that there may be some inhibitory factors in the silkworm egg extract that interfere PCR Amplification of DNA from N.b. silkworm

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Microsporidium molecule universal detection primers and kit thereof
  • Microsporidium molecule universal detection primers and kit thereof
  • Microsporidium molecule universal detection primers and kit thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1 Microsporidia Bombyx mori HMG 1 Gene

[0044] 1. According to the method of gene homologous cloning in the gene cloning technology of molecular biology, No. silkworm was cloned and obtained HMG 1 Gene cDNA and full-length DNA sequences.

[0045] 2. Obtaining the full length of cDNA, the specific method is as follows:

[0046] (1) Using Primer premier 5.0 software, combined with comprehensive analysis, the primers primers HMG1F / HMG1R were designed, and the sequences are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

[0047] Upstream primer HMG1F (SEQ ID NO.3):

[0048] 5' ATGACTGCTCAAAAAGACGATAC 3'

[0049] Downstream primer HMG1R (SEQ ID NO.4):

[0050] 5'TTATTCATCACTATTCTCCTACTTCT 3'.

[0051] (2) Using the purified spore DNA of N.b. silkworm (N.b) as a template, PCR amplification was performed with primers HMG1F / HMG1R.

[0052] (3) The PCR product was purified, connected to pMD19T, and transformed into E.coli DH-5α for culture.

[0053] (...

Embodiment 2

[0057] Example 2 Detection primer design and establishment of PCR amplification method

[0058] 1. Primer design

[0059] Bombyx mori HMG 1 On the basis of genes, multiple pairs of primers were designed by using Primer premier 5.0 software. Through a large number of drug resistance, specificity and sensitivity tests, three pairs of primers were finally selected as representative primer sets. The primer sequences of each set are as follows:

[0060] (1) The first pair:

[0061] Upstream primer HMG1F (SEQ ID NO.3):

[0062] 5' ATGACTGCTCAAAAAGACGATAC 3'

[0063] Downstream primer HMG1R (SEQ ID NO.4):

[0064] 5'TTATTCATCACTATTCTCCTACTTCT 3'.

[0065] (2) The second pair:

[0066] Upstream primer HMG1-sF (SEQ ID NO.5):

[0067] TTCCGAAATAATCTTCTTTTAATTG

[0068] Downstream primer HMG1-sR (SEQ ID NO.6):

[0069] TTGTGCACCGAATCGTAAATAG

[0070] (3) The third pair:

[0071] Upstream primer HMG1-xF (SEQ ID NO.7):

[0072] TCCCTAGGAACTTTTAAAGAGAAG

[0073] Downstream...

Embodiment 3

[0096] Example 3 Primer Specific Detection

[0097] 1. Using the DNA of No. silkworm (N.b), No. tussah mori (N.a), and No. corn borer (N.f) as templates, primers HMG1F / HMG1R, HMG1-sF / HMG1-sR, HMG1-xF / HMG1-xR, carry out PCR amplification with the method of embodiment 2, agarose gel electrophoresis detection result after amplification is finished.

[0098] 2. The amplification results of the three pairs of primers are shown in the attached Figure 4~6 shown. The results showed that both the primers HMG1F / HMG1R and the primers HMG1-xF / HMG1-xR could detect a variety of microsporidia, and had good universal detection ability. However, the primers HMG1-sF / HMG1-sR can only specifically detect N.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a group of microsporidium molecule universal detection primers and a kit thereof. The universal detection primers include an upstream primer HMG1F and a downstream primer HMG1R; the nucleotide sequence of the upstream primer is as shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer is as shown in SEQ ID NO.4. The detection primers target at the gene HMG1 and can be applied to detecting a plurality of microsporidia simultaneously, and the detection results are reliable, easy to operate and high in sensitivity; especially, the universal detection primers have extremely important practical application significance to early detection of various microsporidia in a sample in practical quarantine work.

Description

technical field [0001] The invention belongs to the technical field of insect pathogenic microorganism molecular detection. More specifically, it relates to a set of universal detection primers for microsporidia molecules and a kit thereof. Background technique [0002] The study of silkworm microsporidia began in 1845 with the nationwide epidemic of microsporidia in France. Pasteur determined that the "particles" he observed were the causative factors of microsporidia. sporozoite pathogen. In particular, Nosporum silkworm has two transmission routes, horizontal transmission and vertical transmission, among which vertical transmission causes great harm to the production of silkworm eggs in sericulture production, and at the same time has a great negative impact on the yield and quality of silkworm cocoons in silk cocoon breeding , seriously affecting the development of the downstream economy of the silk industry chain (Cai Shunfeng et al., 2011). Since the outbreak of mi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11
CPCC12Q1/6893Y02A50/30
Inventor 刘吉平宋小景程伟
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com