Universal detection primer and DNA barcode molecular identification method for bursaphelenchus xylophilus and similar species thereof

Abstract

The invention discloses a universal detection primer and a DNA barcode molecular identification method for bursaphelenchus xylophilus and similar species thereof. A forward primer is represented as AGTACCGTGAGGGAAAGTTGA and a reverse primer is represented as GCTACTAGATGGTTCGATTAGTCT; the universal primer can be used for amplifying for D2 / D3 in a ribosomal 28S gene of the bursaphelenchus xylophilus, sequencing an amplified product, comparing the detected sequence with an established sequence standard database of the bursaphelenchus xylophilus and similar species thereof, and rapidly and accurately identifying the bursaphelenchus xylophilus and similar species thereof depending on the differences of DNA sequence of the 28S; and the universal detection primer and the DNA barcode molecular identification method have extensive using value in such aspects as exit and entry plant quarantine, domestic forestry quarantine and forest nematode disease investigation.

Description

technical field [0001] The invention relates to the identification of pine wood nematode and its similar species, in particular to a general detection primer and a DNA barcode molecular identification method of the pine wood nematode and its similar species. Background technique [0002] Pine xylophilus B. xylophilus (Steiner & Buhrer, 1934) Nickle, 1970 is the most destructive pest of pine forests worldwide. The nematode originated in North America and was introduced to Japan in the early 20th century by importing a large number of pine products from the United States, causing the death of a large number of pine trees in Japan. Since then, the nematode was introduced into my country in 1982, South Korea in 1988, Portugal in 1999, and Spain in 2011, all of which caused great harm and attracted great attention from all over the world. Before 2000, there were only three known species of B. xylophilus and its related species, namely B. xylophilus, B. xylophilus and Pseudomon...

AI Technical Summary

Problems solved by technology

With the continuous development of human cognition, similar species of B. xylophilus have been discovered continuously. The previous morphological and classical molecular biology methods on B. xylophilus and its related species are no longer applicable due to their small scope of application and the need for rich identification experience. Adapt to identification needs

The invention patent application with the publication number CN101586160 discloses specific detection primers for pine xylophilus, but it can only carry out DNA molecular identification of pine xylophilus, and cannot identify other known similar species of pine xylophilus