Primers and kit for detecting Asia1-type foot-and-mouth disease virus and preparation method of primers and kit
A detection kit and technology for foot-and-mouth disease, applied in biochemical equipment and methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of inability to type, time-consuming, low sensitivity, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0021] The present invention is explained in detail below in conjunction with embodiment.
[0022] 1. Preparation of Sequences
[0023] According to the GeXP primer design requirements and the FMDV-Asia 1 genome published by NCBI, select the conserved region to design specific primers, and form specific chimeric primers by adding universal primers, while the universal primer sequences belong to non-biologically derived nucleotides In addition, synthesize the universal primer sequence, and add a Cy5 fluorescent label to the 5' end of the upstream universal primer. The primer sequence of the present invention that can specifically amplify the nucleic acid of foot-and-mouth disease Asia type 1 virus is: AGGTGACACTATAGAATAACTGCCTACCAGAAGCAACC, which is named FMDV-Asia 1-F in the present invention; GTACGACTCACTATAGGGAAGTATGTCTCCGCACGCTTC, which is named FMDV-Asia 1-R in the present invention . Universal primers used in the present invention: Cy5 AGGTGACACTATAGAATA, named UWD-F in...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com