Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Multiple PCR identification kit of salmonella and five serotypes of salmonella

A technology for Salmonella, Salmonella enteritidis, applied in the field of biology

Active Publication Date: 2014-10-08
CHINA AGRI UNIV
View PDF5 Cites 20 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Liu Bin et al. (2012) published "Development of a novel multiplex PCR assay for the identification of Salmonella enterica Typhimurium and Enteritidis" in the journal "Food Control", designed primers for the specific fragments of Salmonella typhimurium and Salmonella enteritidis, and performed Identification, limited by the ability to identify only two serotypes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multiple PCR identification kit of salmonella and five serotypes of salmonella
  • Multiple PCR identification kit of salmonella and five serotypes of salmonella
  • Multiple PCR identification kit of salmonella and five serotypes of salmonella

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Embodiment 1, the acquisition of primers used to detect Salmonella and its serotypes

[0041] Using the bioinformatics analysis tool BLAST, the Salmonella-specific sequence InvA gene (sequence 1) and the specific sequences of five serotypes were found in the whole genome: the specific sequence of Salmonella typhimurium (sequence 2), the specific sequence of Salmonella enteritidis (sequence 3), Salmonella Agona specific sequence (SEQ ID 4), Salmonella choleraesuis specific sequence (SEQ ID No. 5), Salmonella pullorum specific sequence (SEQ ID NO: 6); for the six pairs of specific sequences, use PrimerPlex2.61 molecular biology software, Parameter setting: the amplicon length is 100bp-500bp, the primer length is 18-25bp, and six pairs of PCR primers are designed. The primer sequences are as follows:

[0042] Salmonella specific primer sequence:

[0043] InvA-F: GCTCGTAATTCGCCGCCATT; (Sequence 7)

[0044] InvA-R: CATCAGCAAGGTAGCAGTCAGTATT; (Sequence 8)

[0045] Salmonel...

Embodiment 2

[0060] Embodiment 2, be used for detecting the application of the primer of Salmonella and its serotype

[0061] 1. The application of primers in the detection of Salmonella and its serotypes

[0062] 1. Genomic DNA extraction

[0063] 12 strains of Salmonella and 10 strains of non-Salmonella were used for detection, and the composition of the strains is shown in Table 1; Genomic DNA of the 12 strains of Salmonella and 10 strains of non-Salmonella in Table 1 was extracted using a genome extraction kit (Tiangen Company, Cat. No. DP302). The 12 strains of Salmonella included five serotypes of Salmonella: Salmonella Typhimurium, Salmonella Enteritidis, Salmonella Agona, Salmonella Cholerasuis and Salmonella Pullorum.

[0064] Among them, Klebsiella S1, Serratia S2, Citrobacter S3, and Enterobacter cloacae S4 are all recorded in the following literature: He Tao. Drug resistance of Enterobacteriaceae bacteria in zoo primates Investigation and Research. Beijing: China Agricultural...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a multiple PCR identification kit of salmonella and five serotypes of salmonella. The invention provides a primer group for detecting salmonella and five serotypes of salmonella. The primer group comprises a primer pair 1, a primer pair 2, a primer pair 3, a primer pair 4, a primer pair 5 and a primer pair 6. Aiming at specific fragments of salmonella and its five important serotypes (such as salmonella typhimurium, enteritidis, agona, choleraesuis and pullorum), the six pairs of the primers for specific amplification are designed, the amplified fragments comprise 425bp of salmonella, 198bp of salmonella typhimurium, 302bp of salmonella enteritidis, 145bp of salmonella agona, 368bp of salmonella choleraesuis and 249bp of salmonella pullorum, and a sample gene group can be accordingly determined by multiple PCR and electrophoresis detection. Through six pairs of the specific primers and one-step multiple PCR, the salmonella and its five important serotypes can be identified. The multiple PCR identification kit has the characteristics of fast identification rate, low cost, easy operation and easy result determination.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a multiple PCR identification kit for Salmonella and five serotypes thereof. Background technique [0002] Salmonella, as one of the important pathogenic microorganisms, can be transmitted to humans through food, causing symptoms such as gastroenteritis and sepsis, and has become an important foodborne pathogenic microorganism worldwide. Biochemical identification and serotyping are common methods for studying the epidemiology of salmonellosis. Since there are more than 2,600 serotypes of Salmonella, routine serotyping requires a large amount of diagnostic serum, skilled technicians, and cumbersome operating procedures. Due to the existence of monophasic bacteria, conventional serological typing cannot accurately type some Salmonella. Therefore, a simpler, more accurate and faster identification method is of great significance in practice. At present, Salmonella typhimurium, enteri...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11C12R1/42
CPCC12Q1/686C12Q2537/143
Inventor 吴聪明汪洋李瑞超沈建忠
Owner CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products