Multiple PCR identification kit of salmonella and five serotypes of salmonella
A technology for Salmonella, Salmonella enteritidis, applied in the field of biology
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Embodiment 1, the acquisition of primers used to detect Salmonella and its serotypes
[0041] Using the bioinformatics analysis tool BLAST, the Salmonella-specific sequence InvA gene (sequence 1) and the specific sequences of five serotypes were found in the whole genome: the specific sequence of Salmonella typhimurium (sequence 2), the specific sequence of Salmonella enteritidis (sequence 3), Salmonella Agona specific sequence (SEQ ID 4), Salmonella choleraesuis specific sequence (SEQ ID No. 5), Salmonella pullorum specific sequence (SEQ ID NO: 6); for the six pairs of specific sequences, use PrimerPlex2.61 molecular biology software, Parameter setting: the amplicon length is 100bp-500bp, the primer length is 18-25bp, and six pairs of PCR primers are designed. The primer sequences are as follows:
[0042] Salmonella specific primer sequence:
[0043] InvA-F: GCTCGTAATTCGCCGCCATT; (Sequence 7)
[0044] InvA-R: CATCAGCAAGGTAGCAGTCAGTATT; (Sequence 8)
[0045] Salmonel...
Embodiment 2
[0060] Embodiment 2, be used for detecting the application of the primer of Salmonella and its serotype
[0061] 1. The application of primers in the detection of Salmonella and its serotypes
[0062] 1. Genomic DNA extraction
[0063] 12 strains of Salmonella and 10 strains of non-Salmonella were used for detection, and the composition of the strains is shown in Table 1; Genomic DNA of the 12 strains of Salmonella and 10 strains of non-Salmonella in Table 1 was extracted using a genome extraction kit (Tiangen Company, Cat. No. DP302). The 12 strains of Salmonella included five serotypes of Salmonella: Salmonella Typhimurium, Salmonella Enteritidis, Salmonella Agona, Salmonella Cholerasuis and Salmonella Pullorum.
[0064] Among them, Klebsiella S1, Serratia S2, Citrobacter S3, and Enterobacter cloacae S4 are all recorded in the following literature: He Tao. Drug resistance of Enterobacteriaceae bacteria in zoo primates Investigation and Research. Beijing: China Agricultural...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com