Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

High-yield N-acetylglucosamine metabolic engineering bacterium, as well construction method and applications thereof

An acetamido and metabolic engineering technology, applied in the biological field, can solve the problems of low yield, high cost, insufficient purity, etc., and achieve the effects of increasing yield, less accumulation of by-products, preventing backflow and consumption

Active Publication Date: 2014-09-24
EAST CHINA UNIV OF SCI & TECH
View PDF6 Cites 31 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the production of N-acetylglucosamine is mainly formed by the chemical condensation reaction of glucosamine and acetic anhydride, which has defects such as high cost, low yield, and insufficient purity.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-yield N-acetylglucosamine metabolic engineering bacterium, as well construction method and applications thereof
  • High-yield N-acetylglucosamine metabolic engineering bacterium, as well construction method and applications thereof
  • High-yield N-acetylglucosamine metabolic engineering bacterium, as well construction method and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] 1. Using the RED recombination method to inactivate the nagDCABE gene cluster in the strain, the specific steps are as follows:

[0033] 1. According to the sequence of Escherichia coli BL21(DE3) (Invitrogen Company) genome (Genbank No.CP001509), design primers:

[0034] Upstream primer F-KO-nag:

[0035] ATCAGAGCCAACCACGTCCGCAGACGTGGTTGCTATTCAATTCCGGGGATCCGTCGACC (shown in SEQ ID NO.1)

[0036] Downstream primer R-KO-nag:

[0037]TGCGACGCTCAAGCGTCGCATCAGGCATAAAGCAGATTATGTAGGCTGGAGCTGCTTC (shown in SEQ ID NO.2)

[0038] Using primers F-KO-nag and R-KO-nag, plasmid pIJ773 as a template, and using commercial PCR reagents, the DNA fragments were amplified by PCR and purified for future use.

[0039] PCR reaction system: Tag enzyme 0.5 μl, 10×buffer 5 μl, template 1 μl, dNTP (2.5 mmol / L) 4 μl, primers (10 μ mol / L) 1.5 μl each, ddH2O3 6.5 μl;

[0040] PCR reaction process: 94°C for 5min, 94°C for 30s, 55°C for 45s, 72°C for 90s, 30 cycles, 72°C for 10min.

[0041] The o...

Embodiment 2

[0076] 1. The glmS and neuC1 genes were integrated into the chromosome of strain BL21(DE3) / Δnag for expression

[0077] 1. According to the sequence of plasmid pIJ778, design primer F-IJ778-KpnI:

[0078] CTAs GGTACC ATTCCGGGGATCCGTCGAC (shown in SEQ ID NO.9) R-IJ778-XhoI:

[0079] GAT CTCGAG TGTAGGCTGGAGCTGCTTC (shown in SEQ ID NO.10), using the plasmid pIJ778 as a template, PCR amplified to obtain a streptomycin-resistant DNA fragment;

[0080] 2. Purify the above-mentioned DNA fragment, digest it with KpnI and XhoI, and recover it for later use.

[0081] 3. Digest the plasmid vector pETDuet-glmS-neuC1 with KpnI and XhoI, purify it and connect it with the streptomycin-resistant DNA fragment purified in step 2, transform Escherichia coli DH5α, and obtain the integrated vector pETDuet-glmS-neuC-Str .

[0082] 4. Design the upstream primer F-ETDu-fucI:

[0083] ATGAAAAAAAATCAGCTTACCGAAAATTGGTATCCGCCCGTGCGTCCGGCGTAGAGGATC (shown in SEQ ID NO.11) and downstream primer R-E...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a high-yield N-acetylglucosamine metabolic engineering bacterium, as well a construction method and applications thereof. The engineering bacterium is a recombinant Escherichia coli by leading a coded UDP-N-acetylglucosamine epimerase gene and a coded 6-glucosamine phosphate synthetase gene into Escherichia coli for expression, and knocking out the gene N-acetylglucosamine in the Escherichia coli to decompose and utilize metabolic pathway enzyme; and the constructed engineering bacterium strain utilizes glucose as a substrate for fermenting and culturing and synthesizing the N-acetylglucosamine. The engineering bacterium is high in the fermenting level of synthesizing the N-acetylglucosamine by utilizing glucose, the accumulation of side products is less, and industrial production potential capability can be achieved.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a high-yielding N-acetylglucosamine metabolic engineering bacterium and its construction method and application. Background technique [0002] N-acetylglucosamine is a derivative of glucose, widely present in various organisms. Chitin is usually polymerized by beta-1,4-glycosidic bonds. Chitin is the second largest carbohydrate in nature after cellulose. It exists in the cells of lower plant fungi and algae, the shells of arthropod shrimp, crabs and insects, and the cell walls of higher plants. In addition to being a component of chitin, N-acetylglucosamine is also cross-linked with N-acetylmuramic acid through polypeptides to form the main structure of bacterial cell walls-peptidoglycan, and also forms repeating dichotomy with D-glucuronic acid. sugar units to form hyaluronic acid. [0003] N-acetyl glucosamine is used as an antibacterial and anti-inflammatory drug in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/70C12P19/02C12R1/19
Inventor 赵黎明邱勇隽王耀松夏泉鸣蒋丽华范立强周家春
Owner EAST CHINA UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com