Rh blood group DEL phenotype RHD838>A allele and detection method thereof
A technology of alleles and detection methods, applied in genetic engineering, plant genetic improvement, botanical equipment and methods, etc., can solve the problems of cumbersome steps, unsuitable for large-scale clinical application, low reliability, etc., and achieve high sensitivity And the effect of high-precision detection and extensive scientific research application value
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] The preparation of embodiment 1 DNA template
[0026] Use purchased kits to extract genomic DNA from whole blood, and the specific steps are as follows:
[0027] (1) Take a sterile 2.0mL centrifuge tube and add 1mL of cell lysate.
[0028] (2) Gently shake the whole blood sample anticoagulated with EDTA until it is thoroughly mixed; then pipette 500 μL of blood sample into the above-mentioned centrifuge tube containing the cell lysate, and gently pour the centrifuge tube 5-6 times to mix well.
[0029] (3) Incubate at room temperature for 10 minutes (during this period, invert the centrifuge tube 2-3 times to mix well).
[0030] (4) Centrifuge at room temperature for 5 minutes at 12000 rpm.
[0031] (5) Use a pipette to slowly remove the supernatant as much as possible, and be careful not to suck out the white substance at the junction of the two phases.
[0032] (6) Vigorously mix with a vortex shaker (Votex) until the leukocytes are resuspended (10-15 seconds).
...
Embodiment 2
[0043] Example 2 RHD838G>A allele detection technical scheme:
[0044] Instruments: Veriti96 PCR instrument, BIO-RAD Gel Doc XR+ gel imager (Bio-Rad, USA), gel electrophoresis (Beijing Liuyi Company).
[0045] Reagents: QIAamp DNA Extraction Kit (Qiagen, Germany); DNA Isolation Kit Extraction Kit (PELFREEZ, Beijing); PCR buffer, dNTP, Taq enzyme (ABI, USA); primers and probes were purchased from Shanghai Sangon Biotech Co., Ltd. synthesis.
[0046] (1) Primer design: According to the RHD gene (serial number: BN000065) recorded in GenBank of the National Center for Biological Information (NCBI) and the sequences of various RHD alleles in Chinese, primers were designed by Oligo6.0 primer software, and finally 1 For the specific oligonucleotide primer sequence (RHD838A-F, CGGTGTTGGC AGGAGGCGTG G; RHD838A-R, CTTCAGCCAAAGCAGAGGAG G), the length of the amplified product fragment is 163bp;
[0047] A pair of internal control primer sequences were introduced as positive internal ref...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com