Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Rh blood group DEL phenotype RHD838>A allele and detection method thereof

A technology of alleles and detection methods, applied in genetic engineering, plant genetic improvement, botanical equipment and methods, etc., can solve the problems of cumbersome steps, unsuitable for large-scale clinical application, low reliability, etc., and achieve high sensitivity And the effect of high-precision detection and extensive scientific research application value

Inactive Publication Date: 2014-07-23
WUXI NO 5 PEOPLES HOSPITAL
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The detection of DEL blood type by immunoserological method depends on the specificity and operation method of the anti-D antibody used, the reliability is low, and it is not suitable for large-scale clinical application due to cumbersome steps. The reliable method is to apply gene Detection method to detect DEL blood type

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rh blood group DEL phenotype RHD838>A allele and detection method thereof
  • Rh blood group DEL phenotype RHD838>A allele and detection method thereof
  • Rh blood group DEL phenotype RHD838>A allele and detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] The preparation of embodiment 1 DNA template

[0026] Use purchased kits to extract genomic DNA from whole blood, and the specific steps are as follows:

[0027] (1) Take a sterile 2.0mL centrifuge tube and add 1mL of cell lysate.

[0028] (2) Gently shake the whole blood sample anticoagulated with EDTA until it is thoroughly mixed; then pipette 500 μL of blood sample into the above-mentioned centrifuge tube containing the cell lysate, and gently pour the centrifuge tube 5-6 times to mix well.

[0029] (3) Incubate at room temperature for 10 minutes (during this period, invert the centrifuge tube 2-3 times to mix well).

[0030] (4) Centrifuge at room temperature for 5 minutes at 12000 rpm.

[0031] (5) Use a pipette to slowly remove the supernatant as much as possible, and be careful not to suck out the white substance at the junction of the two phases.

[0032] (6) Vigorously mix with a vortex shaker (Votex) until the leukocytes are resuspended (10-15 seconds).

...

Embodiment 2

[0043] Example 2 RHD838G>A allele detection technical scheme:

[0044] Instruments: Veriti96 PCR instrument, BIO-RAD Gel Doc XR+ gel imager (Bio-Rad, USA), gel electrophoresis (Beijing Liuyi Company).

[0045] Reagents: QIAamp DNA Extraction Kit (Qiagen, Germany); DNA Isolation Kit Extraction Kit (PELFREEZ, Beijing); PCR buffer, dNTP, Taq enzyme (ABI, USA); primers and probes were purchased from Shanghai Sangon Biotech Co., Ltd. synthesis.

[0046] (1) Primer design: According to the RHD gene (serial number: BN000065) recorded in GenBank of the National Center for Biological Information (NCBI) and the sequences of various RHD alleles in Chinese, primers were designed by Oligo6.0 primer software, and finally 1 For the specific oligonucleotide primer sequence (RHD838A-F, CGGTGTTGGC AGGAGGCGTG G; RHD838A-R, CTTCAGCCAAAGCAGAGGAG G), the length of the amplified product fragment is 163bp;

[0047] A pair of internal control primer sequences were introduced as positive internal ref...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an RHD838>A allele and a detection method thereof, and belongs to the field of analysis and detection technologies in molecular biology. A primer sequence which can amplify a target part including a mutant gene sequence is designed by a PCR-specific primer technology, and PCR amplification selectively and specially aiming at the specific RHD838>A allele is performed on the zone of the target part including the mutant gene sequence by virtue of a gene amplification method. According to the detection method, the gene level is detected by virtue of a molecular biological method which can be used for greatly improving the sensitivity and specificity of the detection and is simple, convenient and rapid. Since different nationalities have difference in the RHD gene, the detection method is designed specially aiming at the RHD838>A allele according to the RHD genetic molecule background of Chinese on the basis of relative researches. The RHD838>A allele and the detection method thereof have significant clinical meaning in overcoming the shortage of the serological technique, and also have wide scientific research and application value.

Description

technical field [0001] The invention relates to a RHD838G>A allele and a detection method thereof, in particular to a method for doping a known mutant gene in a wild-type gene cluster, and belongs to the technical field of molecular biology analysis and detection. Background technique [0002] The Rh blood group is the most complex and polymorphic system in the human erythrocyte blood group system, and it is also the main erythrocyte blood group that causes clinical transfusion reactions and severe hemolytic disease of the newborn. At present, more than 50 kinds of Rh blood group antigens have been found, among which the RhD antigen has strong immunogenicity and is encoded by the RHD gene, which is the focus of blood group research. Clinically, according to whether the D antigen is detected on the surface of the red blood cell membrane, the Rh blood group antigen is divided into two categories: RhD positive and RhD negative. [0003] In 1984, Japanese scholar Okubo et al...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C12Q1/68
Inventor 王学东顾娟邵超鹏王俊潘兆麟黄利华裴豪陆雁
Owner WUXI NO 5 PEOPLES HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com