Supercharge Your Innovation With Domain-Expert AI Agents!

Rh blood type DEL type RHD1073T>A allele and application thereof

A rh blood type and gene technology, applied in the field of molecular biology, can solve the problems of not being able to obtain correct results, not suitable for large-scale clinical application, and unstable results, and achieve the effect of extensive scientific research and application value

Pending Publication Date: 2020-05-26
ANHUI NO 2 PROVINCE PEOPLES HOSPITAL
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method is not only cumbersome to operate, but also unstable
In addition, due to the influence of disease or other factors, it is difficult to judge the results of red blood cells in some individuals during serological typing; the serological results of patients with chronic long-term blood transfusion sometimes show the phenomenon of "mixed vision"; Sometimes, such as fetal blood group identification, forensic identification of leftovers, etc., serological tests cannot obtain correct results
[0005] The detection of DEL blood type by immunoserological method depends on the specificity and operation method of the anti-D antibody used, the reliability is low, and it is not suitable for large-scale clinical application due to cumbersome steps. The reliable method is to apply gene Detection method to detect DEL blood type

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rh blood type DEL type RHD1073T>A allele and application thereof
  • Rh blood type DEL type RHD1073T>A allele and application thereof
  • Rh blood type DEL type RHD1073T>A allele and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0012] Attached below Figures 1 to 2 The present invention is described further.

[0013] A Rh blood type DEL type RHD1073T>A allelic mutation gene, the mutation occurs at the 25306729 position of chromosome 1, the number of this gene in the NCBl reference database GRCh38.p13 is NC_000001.11 (25272393-25330445), wild type The RHD gene is shown in SEQ ID NO:1, and the mutant RHD gene is shown in SEQ ID NO:2; compared with the wild-type RHD gene, the mutant RHD gene is mutated from base T to base at position 158 of the gene sequence Base A.

[0014] SEQ ID NO:1

[0015] GCTTATAATAACACTTGTCCACAGGGGTGTTGTAACCGAGTGCTGGGGATTCCCCACAGCTCCATCATGGGCTACAACTTCAGCTTGCTGGGTCTGCTTGGAGAGATCATCTACATTGTGCTGCTGGTGCTTGATACCGTCGGAGCCGGCAATGGCA T GTGG GTCACTGGGCTTACCCCCCATCCCCTTAACACTCCCCTCCAACTCAGGAAGAAATGTGTGCAGAGTCCTTAGCTGGGGCGTGTGCACTCGGGGCCAGGTGCTCAGTAGGC TTCGGTGAATTTGTTGGCTGATTTATTCAGAAATTCTGTCCAGCCCCTACCTTG GATGGATTTATCACCTCTCCAGGCCACCTCTTCTTTCCA

[0016] SEQ ID NO:2

[0017] GCTTATAAT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an Rh blood type DEL type RHD1073T>A allele and an application thereof. A wild type RHD gene is represented by SEQ ID NO:1, and a mutant type RHD gene is represented by SEQ IDNO:2. The invention also discloses a specific primer for detecting the mutant gene. The upstream primer sequence of the specific primer is represented by SEQ ID NO:3, the downstream primer sequence ofthe specific primer is represented by SEQ ID NO:4, and the specific primer is used for detecting the RHD1073T>A allele. According to the Rh blood type DEL type RHD1073T > A allele and the applicationthereof, whether mutant genes doped in a gene pool exist or not can be detected in a high-sensitivity and high-precision mode.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to a Rh blood type DEL type RHD1073T>A allele and application thereof. Background technique [0002] The Rh blood group is the most complex and polymorphic system in the human erythrocyte blood group system, and it is also the main erythrocyte blood group that causes clinical transfusion reactions and severe hemolytic disease of the newborn. At present, more than 50 kinds of Rh blood group antigens have been found, among which the RhD antigen has strong immunogenicity and is encoded by the RHD gene, which is the focus of blood group research. Clinically, according to whether the D antigen is detected on the surface of the red blood cell membrane, the Rh blood group antigen is divided into two categories: RhD positive and RhD negative. [0003] In 1984, Japanese scholar Okubo et al. further tested the RhD negative samples confirmed by direct agglutination test and indir...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888C12Q2600/156
Inventor 王学东邵超鹏王保龙王玥苹周道平姬艳丽
Owner ANHUI NO 2 PROVINCE PEOPLES HOSPITAL
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More