A mutant of rhd blood group antigen rhd-g353a and its detection

A technology of blood group antigens and mutants, applied in the field of molecular biology, can solve problems such as inability to obtain correct results and difficult judgment of results, and achieve the effect of extensive scientific research and application value

Active Publication Date: 2020-12-18
WUXI NO 5 PEOPLES HOSPITAL
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, serological techniques have certain limitations
Due to the influence of disease or other factors, it is difficult to judge the results of red blood cells in some individuals during serological typing; the serological results of patients with chronic long-term blood transfusion sometimes show the phenomenon of "mixed vision"; when red blood cells cannot be obtained or the red blood cell samples are insufficient, Such as fetal blood type identification, forensic identification of remnants, etc., serological testing can not obtain correct results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A mutant of rhd blood group antigen rhd-g353a and its detection
  • A mutant of rhd blood group antigen rhd-g353a and its detection
  • A mutant of rhd blood group antigen rhd-g353a and its detection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0011] Attached below Figures 1 to 2 The present invention is described further.

[0012] A RhD blood group antigen RHD-G353A mutant RHD1058G>C allele, wild-type RHD gene such as sequence SEQ ID NO: 1, mutant RHD gene such as sequence SEQ ID NO: 2; compared to wild-type RHD gene , the mutant RHD gene has a gene site mutation of g.25306714G>C, that is, the 80th base G of the mutant RHD gene sequence is mutated to C; the amino acid sequence transcribed from the wild-type RHD gene sequence is SEQ ID NO: 5, the amino acid sequence transcribed from the mutant RHD gene sequence is SEQ ID NO: 6, wherein the 353rd position of the amino acid sequence SEQ ID NO: 6 is changed from glycine G to alanine A.

[0013] SEQ ID NO:1

[0014] ATCATGGGCTACAACTTCAGCTTGCTGGGTCTGCTTGGAGAGATCATCTACATTGTGCTGCTGGTGCTTGATACCGTCG G AGCCGGCAATGGCATGTGGGTCACTGGGCTTACCCCCATCCCCTTAACACTCCCCTCCAACTCAGGAAGAAATGTGTGCAGAGTCCTTAGCTGGGGCGTGTGCACTCGGGGCCAGGTGCTCAGTAGGCTTCGGTGAATATTGTTGGCTGATTTATTCAGAAATTCTGTCCAG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a RhD blood group antigen RHD-G353A mutant and detection. A wild type RHD gene is as shown in a sequence SEQID NO:1, and a mutation type RHD gene is as shown in a sequence SEQID NO:2. The invention relates to a specific primer for detecting RHD1058G > C alleles. The sequence of an upstream primer of the specific primer is as shown in SEQID NO:3, and the sequence of a downstream primer of the specific primer is as shown in SEQID NO:4. According to the RhD blood group antigen RHD-G353A mutant and detection disclosed by the invention, whether mutation genes are mingled ina gene base or not can be detected in a high-sensitivity and high-precision manner.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to a RhD blood group antigen RHD-G353A mutant and its detection. Background technique [0002] The Rh blood group is the most complex and polymorphic system in the human erythrocyte blood group system, and it is also the main erythrocyte blood group that causes clinical transfusion reactions and severe hemolytic disease of the newborn. At present, more than 50 kinds of Rh blood group antigens have been found, among which the RhD antigen has strong immunogenicity and is encoded by the RHD gene, which is the focus of blood group research. Clinically, according to whether the D antigen is detected on the surface of the red blood cell membrane, the Rh blood group antigen is divided into two categories: RhD positive and RhD negative. [0003] At present, the routine detection method of Rh blood group D antigen is identified by serological saline method, indirect antiglobulin t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/12C12N15/11C12Q1/6876C07K14/47
CPCC07K14/47C12Q1/6876C12Q2600/156
Inventor 王学东王玥苹邵超鹏王保龙姬艳丽马静
Owner WUXI NO 5 PEOPLES HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap