Molecular markers m3b-1a and m3b-2a of the qtl locus qphs.sicau-3b.1 for ear germination resistance in wheat and their applications
A molecular marker, m3b-2a technology, applied in biochemical equipment and methods, microbiological determination/inspection, DNA/RNA fragments, etc., can solve economic losses of wheat, increased activity of hydrolytic enzymes, deterioration of wheat food processing quality, etc. question
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0099] Example 1 Mapping of main QTL for wheat CSCR6 resistance to panicle germination and acquisition of molecular markers
[0100] 1) Using CSCR6, an ear-resistant germination wheat material, as the female parent, and crossing the Australian ear-sensing germination variety Lang as the male parent, the hybrid F1 was obtained, and the recombinant inbred line F7 composed of 92 progeny was constructed according to the single-grain transmission method. group.
[0101] 2) RIL F7 panicle germination identification
[0102] Harvest wheat seeds at the wax maturity stage, hang them in a cool and ventilated place to dry naturally for 7 days, and then perform manual threshing. Spread filter paper wetted with 3-5ml distilled water in a covered plastic Petri dish for germination test. The test design is repeated three times, with 50 seeds in each repetition. Pick out the white and moldy seeds every other day, and count them respectively. The germination rate of the seeds is represented ...
Embodiment 2
[0121] Example 2 The application test of the molecular markers of the present invention in the selection of the main effect QTLQPhs.sicau-3B.1 for anti-ear germination
[0122] 1) Using CSCR6 as the female parent and Bellaroi as the male parent, a F7 recombinant inbred line (RILs) consisting of 108 materials was constructed by single seed transmission.
[0123] 2) Mark detection of the obtained F7 progeny, the specific method is: extract the genomic DNA of the F7 generation single plant at the seedling stage; use the genomic DNA as the substrate, and use the developed STS to mark the M3B-1a, M3B-2a The primer pair is used for primers to carry out PCR amplification respectively, and the primers are:
[0124] M3B-1a:
[0125] Forward primer: 5'-3'TGCAGCGTGGTTTGGG
[0126] Reverse primer: 5'-3'TGCAGAGTCAAAGAACTATGATAG
[0127] M3B-2a:
[0128] Forward primer: 5'-3'TTAGTCCACTGAGAACATGGCG
[0129] Reverse primer: 5’-3’ACGTGGGAGGATGTGCAAAG
[0130] PCR amplification system:
...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap