Tat-il-24-kdel fusion protein and its preparation method and application
A technology of TAT-IL-24-KDEL and SUMO-TAT-IL-24-KDEL is applied in the field of TAT-IL-24-KDEL fusion protein and its preparation to achieve the effect of promoting apoptosis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Preparation of TAT-IL-24-KDEL fusion protein
[0041] 1. Construction of pET28a(+) / SUMO-TAT-IL-24-KDEL recombinant plasmid
[0042] a. Obtain the gene encoding the TAT-IL-24-KDEL fusion protein. Using the full-length IL-24 gene as a template, using the upstream primer containing the coding sequence of the TAT penetrating peptide and the downstream primer containing the coding sequence of the endoplasmic reticulum localization signal peptide KDEL, the TAT penetrating peptide and the endoplasmic reticulum were amplified by PCR. The gene encoding the positioning signal peptide KDEL was fused to the N-terminus and C-terminus of the IL-24 gene respectively to obtain the gene encoding the TAT-IL-24-KDEL fusion protein.
[0043] Upstream primer: 5'-CGCGGATCC TATGGCAGGAAGAAGCGTAGACAGAGAGACGTAGA GCCCAGGGCCAAGAGTTCC-3' (the underline indicates the TAT penetrating peptide coding sequence);
[0044] Downstream primer: 5'-CCGCTCGAGTCA GAGCTCGTCCTT GAGCTTGTAGAATTTCTGC-3' (the un...
Embodiment 2
[0060] Activity detection of TAT-IL-24-KDEL fusion protein
[0061] The pro-apoptotic effect and intracellular localization of TAT-IL-24-KDEL fusion protein on breast cancer MCF-7 cells were detected in vitro.
[0062] 1. The apoptosis-promoting effect of TAT-IL-24-KDEL fusion protein on breast cancer MCF-7 cells was detected by flow cytometry, and the specific operations were as follows:
[0063] 1.1. Digest monolayer cultured cells with 0.25% trypsin, prepare single cell suspension with DMEM medium containing 10% fetal bovine serum, and mix 10 6 Cells were inoculated into 60mm culture dishes and cultured in 37°C, 5% CO2 incubator for 24h.
[0064] 1.2. Dilute the fusion protein with serum-free DMEM medium to a solution with a final concentration of 5nM, 10nM and 20nM, add them to the culture dish respectively, and use PBS as a negative control.
[0065] 1.3 After 24 hours, digest with 0.125% trypsin without EDTA, add 3 mL of complete medium to make a single-cell suspension...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap