Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Sweet potato salt-tolerance related protein ibtps and its coding gene and application

A protein and coding technology, applied in sweet potato salt-tolerance-related protein IbTPS and its coding gene and application field, can solve problems such as restricting agricultural crop production, and achieve the effect of broad application space and market prospect

Active Publication Date: 2015-12-30
CHINA AGRI UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

As one of the increasingly serious environmental problems, land salinization seriously restricts the production of agricultural crops

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sweet potato salt-tolerance related protein ibtps and its coding gene and application
  • Sweet potato salt-tolerance related protein ibtps and its coding gene and application
  • Sweet potato salt-tolerance related protein ibtps and its coding gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Embodiment 1, the acquisition of protein IbTPS and its coding gene associated with sweet potato salt tolerance

[0048] 1. Acquisition of salt-tolerance-related protein IbTPS and its coding gene

[0049] Experimental material: sweet potato variety Lushu No. 3 (the public can obtain it from China Agricultural University, and the non-patent literature that has recorded this material is: Zhai Hong, Shang Lili, Liu Qingchang. The construction of the cDNA library of sweet potato D. Analysis of expressed sequence tags. Journal of Agricultural Biotechnology, 2010, 18 (1): 141–148) The expanded leaves of sterile seedlings were removed, quick-frozen in liquid nitrogen, and stored at -80°C.

[0050] 1. Extraction and purification of total RNA from leaves

[0051] Take about 2 g of the expanded leaves of aseptic seedling Lushu No. 3, grind them into powder in liquid nitrogen, put them into a 10 mL centrifuge tube, and extract the total RNA of sweet potato leaves with the Applygen P...

Embodiment 2

[0075] Embodiment 2, the application of IbTPS protein in improving plant salt tolerance

[0076] 1. Acquisition of trans IbTPS tobacco

[0077] 1. Construction of recombinant vector pCBIbTPS

[0078] According to the coding sequence of the sweet potato IbTPS protein cDNA, the primer sequences for amplifying the complete coding sequence were designed, and the forward and reverse primers were respectively introduced into the BamHI and SacI restriction sites. The primer sequences were as follows:

[0079] Primer 11: 5'G GGATCC ATGGTGTCGAGATCATATTCAA' (sequence 5) (the underlined part is the BamHI restriction site),

[0080] Primer 12: 5'TC GAGCTC TTATAGAAGGGCTGTTTGTTGTT3' (SEQ ID NO: 6) (the underlined part is the SacI restriction site).

[0081] Using the DNA molecule shown in sequence 1 in the artificially synthesized sequence listing as a template (or using Lushu No. 3 cDNA as a template), carry out PCR amplification with primer 11 and primer 12 to obtain a 2595bp PCR pr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a protein IbTPS (Ipomoea batatas trehalose-6-phosphate synthase) related to salt resistance of sweet potato as well as an encoding gene and an application of the protein. The protein related to the stress tolerance of a plant is the protein as (a) or (b): (a) the protein consisting of amino acid sequences indicated by a sequence 2 in a sequence table; and (b) the protein which is related to the stress tolerance of a plant and derived from (a) by substituting, and / or deleting and / or adding one or more amino acid residual sequences for an amino acid residual sequence of the sequence 2 in the sequence table. According to the enzyme encoded by the IbTPS gene, the expression of the gene can improve the stress tolerance of the plant. The IbTPS protein and the encoding gene thereof have an important value on increasing the content of mycose and studying the stress tolerance of the sweet potato. The protein IbTPS and the encoding gene have wide application space and market prospect in the agriculture field.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a protein IbTPS related to sweet potato salt tolerance, its encoding gene and application. Background technique [0002] At present, at least 20% of the world's arable land is affected by soil salinization, and nearly 50% of irrigated soil is also affected by salinization to varying degrees. The total area of ​​saline-alkali land in China exceeds 30 million hm 2 , of which about 6 million hm have been reclaimed 2 , and 20 million hm 2 The above salinized land is waiting for reclamation; in addition, there are about 6 million hm in China 2 Secondary salinized soil accounts for about 10% of the total cultivated land area. As one of the increasingly serious environmental problems, land salinization seriously restricts the production of agricultural crops. Therefore, it is one of the most economical and effective measures to use saline-alkali land resources to deeply study the salt-...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/10C12N15/54C12N15/11C12N15/84C12N1/21A01H5/00
CPCC12N9/1051C12N15/8273C12Y204/01015
Inventor 刘庆昌翟红何绍贞姜涛
Owner CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com