Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Tonoplast localization sequence and its application

A tonoplast, sequence technology, applied in the fields of biotechnology and botany

Inactive Publication Date: 2013-08-21
SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] There is no report in the field that the specific signal sequence that determines the localization of the tonoplast membrane has been isolated in plants

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tonoplast localization sequence and its application
  • Tonoplast localization sequence and its application
  • Tonoplast localization sequence and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0094] Embodiment 1, the cloning of gene and the construction of recombinant vector

[0095] 1. Cloning of CBL2 and CBL3 genes

[0096] The 14-day-old wild-type Arabidopsis (Col-0) RNA was extracted, reverse-transcribed into cDNA by ReverTra Ace reverse transcriptase (TOYOBO, Japan), and the gene sequences of CBL2 and CBL3 were respectively amplified using the cDNA as a template. The primers used are as follows:

[0097] CBL2F: CTAATG TCGCAGTGCGTTGACGGT (SEQ ID NO: 7);

[0098] CBL2R: GCCGCTGCTTGCTTTTGCTTTTG (SEQ ID NO: 8);

[0099] CBL3F: CATATG TCGCAGTGCATAGACGGT (SEQ ID NO: 9);

[0100] CBL3R:TTCCCAAATTGTCTCCTCTGCTAA (SEQ ID NO: 10).

[0101] The full-length gene sequences were ligated into the EcoRV digested pBluescript KS (pKS) plasmid (Invitrogen) and sequenced.

[0102] 2. Construction of CBL2-YFP and CBL3-YFP vectors and acquisition of transgenic plants

[0103] Using the pKS plasmids containing CBL2 and CBL3 as templates, high-fidelity Taq enzyme KOS-plus wa...

Embodiment 2

[0138] Embodiment 2, cell localization

[0139] The CBL2 and CBL3 genes in Arabidopsis thaliana were isolated and cloned by molecular cloning technology, and the recombinant vectors for transient expression of CBL2-YFP and CBL3-YFP were constructed.

[0140] The method of PEG-mediated transformation of plant leaf protoplasts (Yoo SD, Cho YH, Sheen J (2007); Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat Protoc 2: 1565-1572) in Arabidopsis 35S:CBL2-YFP and 35S:CBL3-YFP were transiently expressed in mustard protoplasts. Then the position of the fused fluorescent protein was observed under a fluorescent confocal microscope.

[0141] The results showed that the signals of 35S:CBL2-YFP and 35S:CBL3-YFP were clearly localized on the tonoplast membrane of Arabidopsis cells, as shown in figure 1 a.

[0142] In order to exclude the effects of transient expression and high osmotic potential environment, the inventors constructed...

Embodiment 3

[0143] Example 3, Tonoplast Membrane Localization Related Sequences

[0144] Sequence comparison shows that CBL2 and CBL3 have 16 more amino acids than plasma membrane localized proteins such as CBL1 in the same family, which may be very important for its tonoplast localization ( figure 2 Figure below, box marked). Since CBL2 and CBL3 proteins are highly homologous, the inventors further took CBL2 as an object to study the determinants of their tonoplast membrane localization. A recombinant vector expressing the N-terminal 16 amino acids of CBL2 and YFP fusion protein (CBL2N16-YFP) and a recombinant vector expressing CBL2 and YFP fusion protein (CBL2ΔN16-YFP) without the N-terminal 16 amino acids of CBL2 were constructed. After transient expression in Arabidopsis protoplasts, the position of the fused fluorescent protein was visualized under a fluorescent confocal microscope.

[0145] It was found that after removing the 16 amino acids at the front end of CBL2, the protein ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a tonoplast localization sequence and its application. The inventor, for the first time, separates a segment of signal sequence for specific location of cell tonoplast, i.e. a tonoplast targeting sequence (TTS). The sequence can lead accurate and efficient location of protein on intracellular tonoplast. The sequence can be utilized to perform localization transformation on target protein, and expression of the target protein at other sites other than the tonoplast can be reduced or prevented.

Description

technical field [0001] The invention belongs to the fields of biotechnology and botany; more specifically, the invention relates to a tonoplast membrane localization sequence and its application. Background technique [0002] Cells are the basic unit of various life forms, and various proteins are distributed orderly in each division of the cell according to their own characteristics to perform corresponding biological functions (Cavalier-Smith, 2009). The main divisions of plant cells include plasma membrane and other inner membrane systems, nucleus, cytoplasm, and various organelles such as mitochondria, chloroplasts, Golgi apparatus, endoplasmic reticulum, ribosomes, peroxisomes, and vacuoles located therein. These tiny structures or divisions that make up cells are collectively called subcellular structures. In plant cells, a variety of biologically active proteins are distributed on each subcellular structure. The study of protein subcellular localization is an essent...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K7/08C07K14/415C12N15/29C12N15/63C12N5/10C12N1/15C12N1/19C12N1/21A01H5/00
Inventor 张洪霞唐仁杰
Owner SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com