Pharmaceutical applications of traditional Chinese medicine Cassia fistula L. fruit and extract thereof
A sausage bean and application technology, applied in the field of traditional Chinese medicine sausage bean and its extract, can solve the problems of no application of sausage bean, no final determination of anti-HIV active ingredients, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1 Chinese sausage bean original drug and preparation of extract
[0035] The traditional Chinese medicine sausage bean is taken as the original drug, crushed according to the conventional method, sieved to make sausage bean fine powder with a particle size of 60-80 mesh, sterilized, and packaged.
[0036] Weigh 2 kg of sausage bean fine powder, extract three times with 8 liters of 95% ethanol, reflux each time for 3 hours, combine organic phases, and extract 165 grams after concentration. spare.
Embodiment 2H
[0037] Expression, purification, protein activity detection and IC of embodiment 2 HIV-1 protease 50 Determination of value
[0038] 1) Expression and purification of HIV-1 protease:
[0039] a) Amplification of HIV-1 protease fragment and construction of expression vector
[0040] Design primer PCR to amplify the HIV-1 protease coding fragment, recover the PCR product and pET-11a vector and digest it with Nde I and BamH I, recover the target fragment, connect the digested fragment with the linearized vector and transform E. coli.DH5α competent cells. The transformed clones were picked for PCR identification, and the positive clones were subjected to DNA sequencing.
[0041] Gene sequence of HIV-1 protease:
[0042] cctcagatcactctttggcaacgaccccctcgtcacaataaagataggggg
[0043] gcaactaaaggaagctctattagatacaggagcagatgatacagtattag
[0044] aagaaatgagtttgccaggaagatggaaaccaaaaatgatagggggaat
[0045] tggaggttttatcaaagtaagacagtatgatcagatactcatagaaatctg
[0046] cggacataaagctata...
Embodiment 3
[0056] Example 3 Isolation of HIV-1 protease inhibitors from sausage beans
[0057] The extract obtained in Example 1 was used as a sample with 1.4 times the amount of double-distilled water to ultrasonically disperse it for 2 hours, pour it into a separatory funnel, extract it with ethyl acetate and n-butanol, shake it fully, and let it stand for 6 hour, each solvent was extracted 3 times, the organic phase and the aqueous phase were separated, and the extract was concentrated with an EYELAN1001 type rotary evaporator, and the obtained dry paste sausage bean ethyl acetate and n-butanol extracted samples were used as HIV protease inhibitors in vitro Screen and isolate samples.
[0058] The inhibitory effect of the above extracts on HIV protease was tested at a drug concentration of 0.5 mg / mL, and it was found that the ethyl acetate extract had better inhibitory activity, and the inhibitory rate was 83.4%. Therefore, the ethyl acetate extract was selected as the next separatio...
PUM
Property | Measurement | Unit |
---|---|---|
Granularity | aaaaa | aaaaa |
Melting point | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap