Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application method of hypomethylated gene POTEH

A technology of hypomethylation and application methods, applied in biochemical equipment and methods, microbial determination/examination, etc. There is no reference standard for prognostic determination, etc.

Inactive Publication Date: 2012-02-29
CENT SOUTH UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Glioma is the most common and highly malignant tumor of the central nervous system in humans. With the continuous improvement of medical treatment, the 5-year or 10-year survival rate of many tumor patients has been significantly improved, but the prognosis of glioma patients has not been significantly improved. , its 5-year survival rate is less than 25%, while the average overall survival time of patients with glioblastoma is 12.3 months
At present, there is no reference standard for the prognosis of glioma, and there is no specific index, which is far from meeting the needs of the prognosis of human glioma

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application method of hypomethylated gene POTEH
  • Application method of hypomethylated gene POTEH
  • Application method of hypomethylated gene POTEH

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Using Bioinformatics software such as Promoterscan, Genomatix Promoter Inspector and CpGplot to carry out bioinformatics analysis on the 5' end sequence of POTEH gene, the results show that the promoter region of POTEH gene may be located at -817bp to -315bp (in the start codon ATG A is +1). The Methl primer express software and the online software Methprimer analyzed the predicted region of the POTEH promoter, and the results showed that there was a CpG island. The methylated primers for the POTEH promoter region were designed and synthesized, 5′TGATATTTGTGGTTTTAAAGATTTATGTAG 3′(F), 5′ATTACAAACCAACCAAACCATTAC 3′( R). Genomic sequencing (BSP) of 10 cases of normal brain tissue treated with sulfite found that the CpG sites in the CpG island of the POTEH gene promoter were all in a methylated state in normal brain tissue. At the same time, 96 cases of glioma tissue samples of different grades (14 cases of grade I, 48 cases of grade II, 28 cases of grade III, and 12 cases...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an application of hypomethylated gene POTEH, and more specifically an application of hypomethylated gene POTEH in preparing preparations used in brain glioma diagnosing, predicting, detecting, or screening. The invention especially relates to an application of the hypomethylated gene POTEH in preparing preparations used in prognosis of brain glioma predicted by using a bisulfite direct sequencing method. Researches show that, when POTEH is in glioma tissues, promoters are hypomethylated, such that high expression occurs. The detection of POTEH gene hypomethylation is used in brain glioma prognosis, and strong molecular biological evidences are provided for prognosis of brain glioma patients. Therefore, the application method has profound clinical significance and popularization value.

Description

technical field [0001] The invention relates to the application of the hypomethylation gene POTEH in the preparation of a reagent for predicting the prognosis of brain glioma patients. Background technique [0002] Current research defines epigenetics as heritable changes in gene expression that do not alter the DNA sequence. Epigenetic regulatory mechanisms include DNA methylation, histone modification, and microRNAs. So far, a large number of studies have found that epigenetic mechanisms play an important role in the occurrence and development of various tumors (including glioma). Existing studies have shown that the incidence of genome-wide hypomethylation in glioblastoma is about 80%, and single-copy genes and repetitive sequences can also undergo hypomethylation in glioma. [0003] Glioma is the most common and highly malignant tumor of the central nervous system in humans. With the continuous improvement of medical treatment, the 5-year or 10-year survival rate of ma...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor 武明花刘晓萍李桂源唐海林王泽友余志斌卞艳慧
Owner CENT SOUTH UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com