PCR primer pair, kit and method for identifying true cordyceps sinensis and false cordyceps sinensis
A technology of Cordyceps sinensis and primer pairs, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve problems such as high price, scarce resources, and difficulty in wild Cordyceps sinensis, and achieve accurate identification and good application. Foreground effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Example 1 Design and synthesis of detection PCR primers and testing of samples
[0025] 1. Design PCR amplification primers
[0026] The primers were designed according to the Cordyceps sinensis 18s ribosomal gene sequence information publicly registered on GenBank (design primers
[0027] See the part of figure 1 ).
[0028] The sequence information is GenBank: HM135169 (total 1741bp), (Cordyceps sinensis, 18S ribosomal RNA, http: / / www.ncbi.nlm.nih.gov / nuccore / HM135169).
[0029] The upstream primer was designed at 446-466 and named: CC18s-F. The sequence is: 5'CAATAAATACCGATACAGGGC 3'(SEQ ID No.1);
[0030] The downstream primers were designed at 1179-1198 and named: CC18s-R. The sequence is: 5'TGTCTGGACCTGGTGAGTTT 3' (SEQ ID No.2).
[0031] The amplified target sequence is shown in SEQ ID No.3 (446-1198). The region of 579 bases in the middle is preferably the credible interval (see figure 1 underlined part)
[0032] 2. Extract Cordyceps DNA
[0033] Cordyc...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com