Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Lotus phytochelatin synthase NnPCS1 and plant expression vector and construction method thereof

A plant expression vector and enzyme gene technology, applied in the field of lotus plant complexin synthase gene NnPCS1 and its plant expression vector and construction, to achieve the effect of improving heavy metal resistance and plant variety improvement

Inactive Publication Date: 2011-09-21
NANJING AGRICULTURAL UNIVERSITY
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to provide a new phytochelatin synthase gene NnPCS1 to solve the problem of improving the heavy metal resistance of large ornamental aquatic flowers lotus and repairing water pollution.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lotus phytochelatin synthase NnPCS1 and plant expression vector and construction method thereof
  • Lotus phytochelatin synthase NnPCS1 and plant expression vector and construction method thereof
  • Lotus phytochelatin synthase NnPCS1 and plant expression vector and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1 Cloning of NnPCS1

[0033] The lotus variety ‘Donghe’ (Nelumbo nucifera Gaertn. ‘Donghe’) was selected as the material, and 400μMCdCl 2 Treat the 'Winter Lotus' grown to 6 to 8 leaf stage, get its young leaves after 3 hours, refer to the method of Trizol RNA extraction kit (TaKaRa) instruction manual, extract the total RNA of leaves, follow the M-MLV reverse transcription kit ( TaKaRa) 1 μg of total RNA was reverse-transcribed into cDNA.

[0034] Using the extracted leaf cDNA as a template, design primers NnPCS1-F and NnPCS1-R for PCR reaction:

[0035] Upstream primer NnPCS1-F: ATGGCGATGGCAGGTCTATACAGGC (SEQ ID NO.4)

[0036] Downstream primer NnPCS1-R: AGAGACTGAAGGTGTGCTGAGGCCA (SEQ ID NO.5)

[0037] 50 μL reaction system: 5.0 μL 10×RCR Buffer, 1.0 μL each of NnPCS1-F and NnPCS1-R primers (20 μmol L -1 ), dNTP mix 4.0μL (2.5mmol·L -1 ), Taq DNA Polymerase 0.2μL, cDNA template 1μL, ddH 2 O 37.8 μL; reaction program: pre-denaturation at 95°C for 4 min, t...

Embodiment 2

[0038] Example 2. Construction of plant expression vector pCAMBIA1301-220-NnPCS1

[0039]Primers NnPCS1-ZF and NnPCS1-ZR were designed for PCR reaction, restriction sites Bam I and Sac I were introduced into the upstream and downstream of the target gene NnPCS1 respectively, the PCR product was connected to the pMD19-T Simple vector, transformed into TOP10 competent cells, and extracted Positive plasmid, Bam I and Sac I double-digested NnPCS1 fragment was ligated with Bam I and Sac I double-digested pCAMBIA1301-220, transformed, extracted positive, electrophoresis detected and sequenced to verify that it was SEQ ID NO.1, specific steps as follows:

[0040] Upstream primer NnPCS1-ZF: CGCGGATCCATGGCGATGGCAGGTCTATACAGGC (SEQ ID NO.2)

[0041] Downstream primer NnPCS 1-ZR: CGAGCTCAGAGACTGAAGGTGTGCTGAGGCCA (SEQ ID NO.3)

[0042] ①Using cDNA of lotus leaf as template, high-fidelity enzyme (PrimeSTAR TM HS DNA Polymerase, TaKaRa) for PCR reaction, 50 μL reaction system: 10×HS RCR...

Embodiment 3

[0044] Example 3 Genetic transformation of Arabidopsis thaliana with plant expression vector pCAMBIA1301-220-NnPCS1 and identification of its resistance to heavy metals

[0045] ① Competent preparation and freeze-thaw transformation of Agrobacterium strain EHA105

[0046] Pick a single colony of EHA105 from the YEB (50ug / mL rifampicin) plate, inoculate it in 50mL YEB liquid medium containing 50ug / mL rifampicin, culture at 200rpm, 28°C until the OD value is 0.5, and then ice-bath the bacteria solution 30min, centrifuge to collect the bacteria, suspend in 2mL pre-cooled 100mM CaCl 2 (20% glycerol) solution, 200uL / tube aliquoted for use.

[0047] Take 10uL pCAMBIA1301-220-NnPCS1 vector plasmid, add 200uL EHA105 competent cells, ice bath for 30min, freeze in liquid nitrogen for 5min, 37°C for 5min, add 800uL YEB liquid medium, pre-culture at 28°C 200rpm for 4h, and spread the bacterial solution on YEB (50ug / mL rifampicin + 50ug / mL kanamycin) solid medium, cultured in the dark at...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of molecular biology and discloses a lotus phytochelatin synthase gene NnPCS1 and a plant expression vector and a construction method thereof. The sequence of the lotus phytochelatin synthase gene NnPCS1 is represented by SEQ ID No.1. The NnPCS1 is a new heavy metal resistance associated gene and can improve the heavy metal resistance in plants. The plant expression vector of the lotus phytochelatin synthase gene NnPCS1 consists of the lotus phytochelatin synthase gene NnPCS1 and the plant expression vector. The plant expression vector of the NnPCS1 is reported for the first time, can be directly used in Agrobacterium tumefaciens-mediated genetic transformation to develop a new heavy metal resistant variety and improve the heavy metal resistance in the plants and can be used for plant variety improvement.

Description

technical field [0001] The invention belongs to the field of molecular biology, and relates to lotus plant complexin synthase gene NnPCS1 and its plant expression vector and construction method. Background technique [0002] Heavy metal pollution is the main aspect of environmental pollution. According to statistics, the area of ​​cultivated land polluted by heavy metals such as Cd, As, Cr and Pb in my country is nearly 20 million hm2, accounting for about 1 / 5 of the total cultivated land area; among them, 10 million hm2 of cultivated land is polluted by industrial "three wastes", and the area of ​​farmland irrigated by sewage has reached 10 million hm2. Up to more than 3.3 million hm 2[1] . Therefore, the distribution, migration, and transformation of heavy metals in the environment have always been one of the research hotspots in the field of environmental science. [2] . In recent years, the use of phytoremediation of soil and water polluted by heavy metals has been pro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/54C12N15/84A01H5/00
Inventor 刘兆磊顾春笋陈发棣陈素梅陈思思
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com