Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Fluorescence quantitative PCR (Polymerase Chain Reaction) detection method and kit for HPIV (Human Parainfluenza Virus)

A fluorescence quantitative and detection method technology, applied in the field of molecular biology, can solve the problems of difficult detection, and achieve the effect of long time, high specificity and easy operation

Inactive Publication Date: 2011-07-06
SHANGHAI XINGYAO MED TECH DEV CO LTD +1
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Type IV is difficult to detect, probably because it rarely causes serious disease

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescence quantitative PCR (Polymerase Chain Reaction) detection method and kit for HPIV (Human Parainfluenza Virus)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0028] According to the comparison and analysis of HPIV-related sequences (HPU70948) in GeneBank, primers and probes were designed and prepared:

[0029] Primer 1: 5`-ATGTGCTATCAAGACCAGGAAAC-3` (Seq No.1)

[0030] Primer 2: 5`-CGTTTACTCTTTTCGGTTGCTGT-3` (Seq No.2)

[0031] Probe 1: 5`ACTGGGTTCACTCTCGATTTTTGT-3` (Seq No.3)

[0032] Design and prepare synthetic RNA sequences:

[0033] 5-AUGUGCUAUCAAGACCAGGAAACAAUGAAUAGACUCACAAAAAUCGAGAGUGAACCCAGUCAUCAACAGCAACC

[0034] GAAAGAGUAAACG-3` (Seq No.4)

[0035] The artificially synthesized RNA sequence was dissolved in DEPC-treated water and diluted to 1E+6copies / ml, 1E+5copies / ml and 1E+4copies / ml, which were successively used as calibrator 1-3.

[0036] One step RT-PCR reaction buffer (final concentration) was prepared according to the following formula: 50mM Tris-HCl (Ph 8.3), 50mM KCl, 300uM dNTP, 3mM MgCl2, 200nM primer 1, 200nM primer 2 and 200nM probe 1.

[0037] Probes (final concentration) were prepared according to the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a fluorescence quantitative PCR (Polymerase Chain Reaction) detection method and a kit for an HPIV (Human Parainfluenza Virus). A detection primer and a probe are designed in specific to an HPIV gene sequence conserved fragment, and RNA (Ribose Nucleic Acid) of the HPIV is detected qualitatively and quantificationally by using an improved one-step method and an RT-PCR (Reverse Transcription-Polymerase Chain Reaction) real-time fluorescence amplification technology. The method has the advantages of easiness in operating, high repeatability and high specificity and sensitivity.

Description

technical field [0001] The invention relates to a HPIV virus fluorescent quantitative PCR detection method and a kit, belonging to the field of molecular biology. Background technique [0002] clinical manifestations [0003] Human parainfluenza viruses (HPIVs) often cause lower respiratory tract infections in children, and their pathogenicity is second only to respiratory syncytial virus (RSV). Like RSV, human parainfluenza viruses can cause recurrent upper respiratory tract infections (such as colds and sore throats). It can also cause severe recurrent lower respiratory tract disease (eg, pneumonia, bronchitis, and bronchiolitis), especially in the elderly and in immunocompromised persons. Each of the four subtypes of human parainfluenza virus has distinct clinical and epidemiological characteristics. The most typical clinical feature of type I and type II is to cause laryngotracheobronchitis in children, type I is the main cause of laryngotracheobronchitis in children,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68G01N21/64C12R1/93
Inventor 何剑军夏懿吴大治韩倩沈维祥
Owner SHANGHAI XINGYAO MED TECH DEV CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com