Human recombination Reg4 protein and coding gene thereof as well as preparation method thereof
A technology of human recombination and protein, applied in the field of genetic engineering, can solve the problems of difficult purification and low content, and achieve the effect of low cost, high activity and simple process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0059] Step 1, construction of human recombinant Reg4 protein expression vector
[0060] Primer 5'GGAATTC from human liver cDNA CATATG GATATCATCATGAGACCCAGC 3' (SEQ ID NO: 4) and reverse primer 5'CG GGATCC CTATGGTCGGTACTTGCACAGG 3' (SEQ ID NO: 5) (synthesized by Shanghai Sangon) PCR produced human Reg4 gene. The parts underlined in the primers are the restriction sites of NdeI and BamH I. The PCR conditions are: 94°C for 2 minutes: 94°C for 30 seconds, 58°C for 30 seconds, 68°C for 30 seconds, 35 cycles. PCR product gel electrophoresis, recovery of DNA fragments of about 500bp (see figure 1 ), digested with Nde I and BamH and packaged the fragments cut into Nde I and BamH double digested pET30a plasmid and sequenced (Invitrogene). Positive clones were selected with a karimycin plate, and plasmids were extracted from the positive clones, and the correctly packaged plasmid (SEQ ID NO: 2) was verified by Nde I and BamH double enzyme digestion and sequencing. figure 1 It is...
PUM
Property | Measurement | Unit |
---|---|---|
concentration | aaaaa | aaaaa |
purity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap