Primer and probe sequence for multifluorescent PCR synchronous detection of Salmonella, Vibrio parahaemolyticus and Escherichia coli O157:H7

Abstract

The invention provides a primer and a probe sequence for multiple fluorescence PCR synchronous detection of nucleotide segments of three types of malignant bacteria of salmonella, vibrio parahaemolyticus and bacillus coli O157:H7. The primer sequence is shown as follow: a target gene of the salmonella is invA, an upstream primer sequence of the salmonella is TGCGGTACTGTTAATTACCACGC, a downstream primer sequence of the salmonella is GGCATCGGCTTCAATCAAGA, the target gene of the vibrio parahaemolyticus is toxR, the upstream primer sequence of the vibrio parahaemolyticus is CATTCGCGTGGCAAACATC, the downstream primer sequence of the vibrio parahaemolyticus is GCGACCTTTCTCTGAAATATTAATTGT, the target gene of the bacillus coli O157:H7 is RFBE, the upstream primer sequence of the bacillus coli O157:H7 is TGGCATGACGTTATAGGCTACAAT, the downstream primer sequence of the bacillus coli O157:H7 is AGCTTGTTCTAACTGGGCTAATCCT. The probe sequence is shown as follow: the target gene of the salmonella is invA, the probe sequence of the salmonella is TGGCATTATCGATCAGTACCAGCCGTC, the target gene of the vibrio parahaemolyticus is toxR, the probe sequence of the vibrio parahaemolyticus is CGCACAAGGCTCGACGGCTGA, the target gene of the bacillus coli O157:H7 is RFBE, and the probe sequence of the bacillus coli O157:H7 is ATAGGATGACAAATATCTGCGCTGCT.

Description

【Technical field】 [0001] The present invention relates to a method for Salmonella, Vibrio parahaemolyticus and Escherichia coli O 157 :H 7 Primer and probe sequences for multiplex fluorescent PCR simultaneous detection of nucleotide fragments of three pathogenic bacteria. 【Background technique】 [0002] Salmonella, Vibrio parahaemolyticus, and Escherichia coli O 157 :H 7 It is an important food-borne pathogen. It mainly infects humans through contaminated animal-derived food such as aquatic products, causing food poisoning, typhoid fever, uremia, etc., and can lead to death in severe cases. Therefore, these three pathogenic bacteria have attracted much attention, and they are pathogenic bacteria that must be inspected or monitored for imported and exported aquatic products and other animal-derived products in my country and most developed countries in the world. [0003] Aquatic products are the main agricultural products exported to Europe and the United States, and hav...

AI Technical Summary

Problems solved by technology

However, there is no method and related standards that can simultaneously detect multiple pathogenic bacteria in aquatic products

Although there are various rapid detection methods for the detection of these three pathogenic bacteria, such as immunomagnetic strain enrichment method, enzyme-linked immunosorbent assay, automatic enzyme-linked immunofluorescence method, chromogenic medium method, DNA probe technology, PCR technology, etc., but these methods have not been widely promoted due to their shortcomings of one kind or another. In fact, the inspection of pathogenic bacteria in aquatic products by relevant departments in my country basically remains on the traditional bacterial isolation and cultivation, which is not only time-consuming, but often requires 4 ~7 days, it may also be missed due to complicated operations and many reagents used

From January to July 2005, 11 batches of my country's aquatic products exported to the United States were detained due to the detection of Salmonella by the US FDA, causing large economic losses to the enterprise

Images