Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

RNAi therapeutics for treatment of eye neovascularization diseases

A new blood vessel, eye disease technology, applied in DNA/RNA fragments, drug combinations, sugar derivatives, etc., can solve problems such as failure to work

Inactive Publication Date: 2007-10-10
INTRADIGM CORP
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although studies in ocular angiogenesis as well as in other angiogenic diseases such as tumor growth have demonstrated the value of the VEGF pathway for clinical efficacy, experimental drugs have been far from effective in many trial subjects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RNAi therapeutics for treatment of eye neovascularization diseases
  • RNAi therapeutics for treatment of eye neovascularization diseases
  • RNAi therapeutics for treatment of eye neovascularization diseases

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0082] Example 1. Topical and Systemic Administration of VEGF Pathway Inhibitors to Treat Anterior Eye NV Disease Mouse SK Model, Virus and Tissue Culture

[0083] An ocular stromal keratitis (SK) BALB / c mouse model has been reported in which corneal NVs were implanted into the stroma by a micropouch approach with CpG DNA oligonucleotides (CpG ODN, containing NV-inducible motif equivalents of the HSV DNA genome) Induction, or HSV-1 virus infection by corneal scratch method to induce. The sequences of the stimulating ODN used in this study are: 1466, TCAACGTTGA and 1555, GCTAGA CGTTAGCGT (provided by Dr. Dennis M. Klinman, Center for Biologics Evaluation and Research, US FDA). Microspheres for implantation into corneal micropockets contained an equimolar mixture of ODN 1466 and 1555 and a previously reported hydron polymer. Use HSV-1 RE strain (provided by Dr. Robert Lausch of Uni.Alabama, Mobile) with 2-μl 1×10 per eye 5 Doses of plaque-forming units induce HSK. To test the...

Embodiment 2

[0140] Example 2. Topical Administration of VEGF Pathway Inhibitors for Posterior Ocular NV Disease

[0141] Materials and methods

[0142]Pups of the same surrogate mother were treated with hypoxia (75%) from P7 to P12 and switched to normal air (normoxia) from P12 to P16. (P number refers to the number of days). Subconjunctival administration of siRNA complexed with the cationic polymer reagent PolyTran PT73 was employed. The ratio of siRNA to PT73 was 1:8 by weight. The mixture was diluted to the required volume with 5 mM HEPES solution. The siRNA dose was 4 μg siRNA (in PT73 complex) per eye dispersed in a volume of 5 μl. One injection each at P12 and P13. The left eye of each mouse was treated with negative control siRNA, siLuc, and the right eye was treated with active siRNA, siMix. Negative control siLuc was an equal mixture of two oligonucleotides (siLuc-a and b). siMix is ​​an equal mixture of simVEGFA, simVEGFR1 and simVEGFR2, each of which is a mixture of two...

Embodiment 3

[0145] Example 3. Distal Systemic Administration of VEGF Pathway Inhibitors to Treat Novel Tumor Model Systems

[0146] Angiogenesis

[0147] Materials and methods

[0148] nucleic acid

[0149] Based on the study by Elbashir et al. (2), short double-stranded RNA oligonucleotides for siRNA-tagged siLuc, siLacZ, siGFP, and siVEGFR2 were designed, lacking significant interfering homology as confirmed by BLAST analysis, and synthesized by Dharmacon (Lafayette, CO) and purification. Two sequences were synthesized per target, combined in a 1:1 molar ratio. 所用的靶序列为,siLuc:aaccgctggagagcaactgca和aagctatgaaacgatatgggc,siLacZ:aacagttgcgcagcctgaatg和aacttaatcgccttgcagcac,siGFP:aagctgaccctgaagttcatc和aagcagcacgacttcttcaag,siVEGFR2:aatgcggcggtggtgacagta和aagctcagcacacagaaagac(已描述了此siRNA对VEGF R2的抑制作用(28))。 siRNA targeting luciferase was labeled with luciferin at the 3' position of the sense strand by standard bond chemical conjugation (FITC-siRNA) for FACS analysis and tissue distribution ex...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Compositions and methods for treating ocular disease are provided. Specifically, siRNA molecules and mixtures of siRNA molecules are provided that inhibit angiogenesis and / or neovascularization in the eye are provided. The compositions and methods are suitable for treating ocular diseases associated with angiogenesis and / or neovascularization.

Description

[0001] This application claims priority to US Provisional Application Serial No. 60 / 541,775, filed February 5, 2004, the contents of which are hereby incorporated by reference in their entirety. Background of the invention [0002] Many different eye diseases are the result of excessive neovascularization (NV) - the abnormal proliferation and growth of blood vessels inside the eye. The development of ocular NV itself not only has adverse consequences on vision, but is also an early pathological step in many serious eye diseases; despite the introduction of new therapeutic agents, it remains the most common cause of permanent blindness in the United States and Europe. Several major eye diseases promote abnormal neovascularization, leading to further damage leading to blindness. Unfortunately, few treatment options exist for patients with any of these ocular NV diseases. The most commonly approved treatment is Visudyne photodynamic therapy, which uses light to activate photosen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07H21/04A61K48/00
CPCA01K67/0271A01K2207/05A01K2217/05A01K2227/105A01K2267/0331A61K49/0008A61K49/0043A61K49/0054C12N15/1136C12N15/1138C12N2310/14C12N2320/31A61P27/02
Inventor Q·唐P·Y·卢F·Y·谢M·C·伍德尔
Owner INTRADIGM CORP
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com