Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for reforming high-virulent nuclear polyhedrosis virus of lepidoptera pest

A karyotype polyhedron and lepidopteran technology, applied in the biological field, can solve the problems of long incubation period, unsatisfactory control effect, slow insecticidal speed, etc.

Inactive Publication Date: 2009-08-19
ZHEJIANG UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the wild-type NPV virus strain has a long incubation period after infection, slow insecticidal speed, and unsatisfactory control effect.
Therefore, the popularization and application of NPV biopesticides in actual production is still relatively limited.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for reforming high-virulent nuclear polyhedrosis virus of lepidoptera pest

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0019] Example NPV construction method containing tea geometrid chitin synthase (CS) antisense gene sequence:

[0020] 1) Take about 100 mg of 1 third-instar tea geometrid larvae, extract total RNA with Trizol (Invitrogen Company) reagent, detect RNA quality by electrophoresis, and analyze RNA concentration with GENQUENT. Refer to the reagent and instrument instructions for specific operations;

[0021] 2) Synthesize the first strand of cDNA of tea geometrid larvae with the MMLV first strand cDNA synthesis kit, and refer to the kit instructions for specific operations;

[0022] 3) Perform RT-PCR with the following primer pairs containing restriction sites, and the PCR conditions are shown in Table 1;

[0023] L 5'AA TCTAGA TTCGAATACGCCATCGGCCATTGG (the underlined part is the Xba I restriction site)

[0024] R 5'AA GGATCC CCAACGATCCTCGCCCTGATCGTACTG (the underlined part is the restriction site of BamH I)

[0025] Table 1

[0026] PCR reaction system

PCR re...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The method for transforming Lepidopteran pest nuclear polyhedrosis virus belongs to the field of biotechnology, and relates to a method for transforming wild nuclear polyhedrosis virus (NPV) by using antisense gene technology and constructing a new Lepidoptera pest NPV. The invention scheme mainly includes the following steps: ① cloning of chitin synthase (CS) conserved sequence of lepidopteran pests such as inchworms; ② construction of antisense CS gene transfer vectors for lepidopteran pests; ③ recombinant NPV; ④ methods such as PCR Verify the recombinant NPV; ⑤Using the wild NPV virus as a control, evaluate and screen the insecticidal ability of the recombinant NPV to obtain a highly virulent recombinant NPV virus strain. The NPV transformed by the method of the present invention has faster diffusion and reinfection speed, and has higher toxicity to Lepidoptera pests.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a method for transforming wild nuclear polyhedrosis virus (NPV) by antisense gene technology and constructing a novel NPV of lepidopteran pests. Background technique [0002] Lepidoptera insects, such as inchworms and caterpillars, are one of the important pest species that damage crops. When these pests occur in large numbers, they cause severe crop yield and quality deterioration. Therefore, Lepidoptera insects such as inchworms are one of the important control objects in crop production. At present, there are two main types of pesticides used in production: one is chemically synthesized pesticides, such as pyrethroid pesticides, organophosphorus pesticides and diflubenzuron, etc.; the other is biological pesticides, such as nuclear polyhedrosis virus (NPV) preparations , Bacillus thuringiensis (Bt) preparations and some predatory insects, etc. Chemically synthesized pesticides ha...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N7/01C12N15/63C12N15/66C12Q1/68A01N63/00
Inventor 陆建良林晨梁月荣张广辉杜颖颖叶俭惠
Owner ZHEJIANG UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com