Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Process for screening compound having affinity for vitamin D receptor

A technology for compounds, vitamins, applied in the field of screening

Inactive Publication Date: 2002-03-20
CHUGAI PHARMA CO LTD
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] However, there have been no reports to date of attempts to separate vitamin D receptor-associated, VDRE-mediated pro-transcriptional activity from vitamin D receptor-associated repression of transcription factor activity in vitamin D derivatives; Such as AP-1 complex or NF-κB family have this inhibitory effect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Process for screening compound having affinity for vitamin D receptor
  • Process for screening compound having affinity for vitamin D receptor
  • Process for screening compound having affinity for vitamin D receptor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0094] The present invention will be described in more detail by the following examples, but the present invention is not limited by these examples. Example 1: Screening system (A) Evaluation of inhibitory activity of AP-1 complex and NF-κB family by reporter gene assay system (1) Reporter gene carrier with AP-1 binding sequence or NF-κB binding sequence

[0095] The base vector was constructed by inserting the promoter region (-72 / +47) of the human IL-2 gene into a luciferase cassette vector (pXP2; described in S.K. Nordeen, Biotechnology, 6, 454-456 (1988)). For the reporter gene vector containing the AP-1 binding sequence, five AP-1 binding sequences (ATGAGTCAG) of the human collagenase (MMP-1) gene were inserted in series into the base vector. For the reporter gene vector containing the NF-κB binding sequence, four kinds of NF-κB binding sequences (CAGAGGGGACTTTTCCGAGA) of the human immunoglobulin light chain κ gene were inserted in series into the basic vector. The resul...

Embodiment 2

[0116] The above results demonstrate the possibility of isolating the VDRE-mediated transcription-promoting activity of vitamin D derivatives from their inhibitory activity on the AP-1 complex or the NF-κB family. Example 2: Compound No. 22 and 1α, 25-dihydroxyvitamin D in osteoporosis model rats 3 Effect on bone mass reduction (subcutaneous treatment) (A) Experimental method

[0117] Ovariectomy was performed on 7-9 week old W-I female rats (Imamichi Institute of Animal Reproduction). 0.01-0.04 μg / kg 1α,25-dihydroxyvitamin D starting from the next day 3 Dose, or 0.01-0.1 μg / kg dose of Compound No. 22, subcutaneously administered 1α, 25-dihydroxyvitamin D 5 times a week 3 or Compound No. 22 for 6 weeks. After the last administration, 24-hour urine was sampled and blood was collected under ether anesthesia. After euthanizing the animal, remove the lumbar spine.

[0118] Lumbar bone mineral density at the third lumbar vertebra was measured with a dual X-ray bone mineral con...

Embodiment 3

[0124] Compound No. 22 has an affinity for vitamin D receptors of 1α, 25-dihydroxyvitamin D 3 0.8 times. Example 3: Compound No. 22 and 1α-hydroxyvitamin D in osteoporosis model rats 3 Effect on bone mass reduction (oral treatment) (A) Experimental method

[0125] Ovariectomy was performed on 8-week-old W-I female rats (Imamichi Institute of Animal Reproduction). Oral administration of 1α-hydroxyvitamin D at a daily dose of 0.1 μg / kg in a single dose or divided into two doses 5 times a week starting from the next day 3 Dosage, or Compound No. 22 was administered orally daily at a daily dose of 3 μg / kg for 5 weeks. After the last administration, 24-hour urine samples were taken, and blood samples were taken under ether anesthesia. After euthanizing the animal, remove the lumbar spine. Lumbar bone mineral density at the third lumbar vertebra was measured with a dual X-ray bone mineral content measuring device (DCS-600EX, ALOKA). Blood and urine calcium concentrations and u...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A method for screening a vitamin D derivative wherein the blood calcium level-elevating effect alone has been relieved or eliminated while sustaining useful physiological activities. A method for screening a compound having an affinity for vitamin D receptor which comprises measuring the activity of a test compound of promoting the VDRE-mediated transcription by vitamin D receptor and the effect of the test compound of inhibiting the activity of the transcription factor of the vitamin D receptor, thereby selecting a compound showing the transcription factor activity inhibitory effect relatively stronger than the VDRE-mediated transcription promoting activity.

Description

technical field [0001] The present invention relates to a novel method for screening vitamin D derivatives which do not cause adverse reactions and retain useful physiological activities. More specifically, the present invention relates to a screening method comprising measuring the (vitamin D receptor-related) transcription-promoting activity of a test compound mediated by a vitamin D responsive element (hereinafter referred to as "VDRE"), and the test Inhibitory activity of compounds (vitamin D receptor-associated) on the transcriptional regulatory activity of other specific transcription factors. The present invention also relates to the compound screened by the screening method and the medicine containing the compound. Background technique [0002] active vitamin D 3 Derivatives, such as 1α, 25-dihydroxyvitamin D 3 or 1α-hydroxyvitamin D 3 , has been widely used clinically as a drug for the treatment of metabolic bone diseases such as osteoporosis. Active Vitamin D ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K31/59G01N33/82
CPCA61K31/59G01N33/82G01N2500/00A61P19/10G01N2500/04
Inventor 内山也寸志佐藤秀树掛武威
Owner CHUGAI PHARMA CO LTD
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More