Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Rhodosporidium toruloides promoter and application thereof

A Rhodosporidium saccharomyces, promoter technology, applied in the direction of using vectors to introduce foreign genetic material, peptides, DNA/RNA fragments, etc., can solve problems such as unreported

Active Publication Date: 2022-05-27
KUNMING UNIV OF SCI & TECH
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, it has been reported that the U6 promoter has been successfully applied to homology repair and gene knockout in the CRISPR / Cas9 system of some different organisms, but the application of the U6 promoter to Rhodosporidium has not been reported yet.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rhodosporidium toruloides promoter and application thereof
  • Rhodosporidium toruloides promoter and application thereof
  • Rhodosporidium toruloides promoter and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Example 1: gRNA promoter P RkU6a , P RkU6b acquisition

[0021] 1. gRNA promoter prediction

[0022] with brown decay fungus ( Coniophoraputeana ), Heterobasidiomycota mutans ( Heterobasidionirregulare ), Arabidopsis ( Arabidopsis ), Drosophila ( Drosophila melanogaster ), mice ( Mus musculus ), Schizosaccharomyces pombe ( Schizosaccharomyces pombe ), Aureobasidium racemosa ( Lichtheimiaramosa ), Rhodosporidium toruloides ( Rhodospordiumtoruloides ), Penditum spp. ( Melanopsichiumpennsylvanicum ), filamentous black powder fungus ( Sporisoriumreilianum ) and other species U6 genes were compared as the reference sequence, and a highly homologous sequence AGAGAAGATTAGCATGGCCCCTGCACAAGGATGACAC was obtained. BLAST was used to compare the highly homologous sequence with the whole genome sequence of Rhodosporidium YM25235, and two sequences were obtained and successfully located. to the U6 boot sequence TATA box (see figure 1 ), take the sequence about 2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a rhodosporidium promoter. The nucleotide sequences of the rhodosporidium promoter are shown as SEQ ID NO: 1 and SEQ ID NO: 2; the two U6 gene promoters obtained from the rhodosporidium are applied to a CRISPR / Cas9 gene editing system of the rhodosporidium, the expression of gRNA in the system is guided, efficient fixed-point gene knockout is achieved, a set of efficient genetic manipulation tool is provided for the rhodosporidium, and important research significance and application value are achieved.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to two Rhodosporidium yeast promoters and applications thereof. Background technique [0002] Rhodosporidium ( Rhodosporidiumkratochvilovae ) YM25235 is an oleaginous red yeast strain isolated from Chenghai Lake, Yunnan, with low temperature adaptability. It can grow at 15°C and can produce carotenoids and polyunsaturated fatty acids (PUFA). Therefore, Rhodosporidium can be considered as an alternative source of carotenoids and PUFA industrial products, with great industrial prospects. [0003] CRISPR / Cas9 (Clustered regulatory interspaced shortpalindromicrepeats / Crispr-associated protein 9) gene editing system, as a technology for targeted gene modification, has the characteristics of simplicity and efficiency, and is getting more and more attention. This mechanism was first discovered in bacteria, and it is an adaptive immune system evolved by bacteria to resist foreign ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/81
CPCC07K14/39C12N15/815Y02A50/30
Inventor 张琦郭锐
Owner KUNMING UNIV OF SCI & TECH
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More