Rhodosporidium toruloides promoter and application thereof
A Rhodosporidium saccharomyces, promoter technology, applied in the direction of using vectors to introduce foreign genetic material, peptides, DNA/RNA fragments, etc., can solve problems such as unreported
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] Example 1: gRNA promoter P RkU6a , P RkU6b acquisition
[0021] 1. gRNA promoter prediction
[0022] with brown decay fungus ( Coniophoraputeana ), Heterobasidiomycota mutans ( Heterobasidionirregulare ), Arabidopsis ( Arabidopsis ), Drosophila ( Drosophila melanogaster ), mice ( Mus musculus ), Schizosaccharomyces pombe ( Schizosaccharomyces pombe ), Aureobasidium racemosa ( Lichtheimiaramosa ), Rhodosporidium toruloides ( Rhodospordiumtoruloides ), Penditum spp. ( Melanopsichiumpennsylvanicum ), filamentous black powder fungus ( Sporisoriumreilianum ) and other species U6 genes were compared as the reference sequence, and a highly homologous sequence AGAGAAGATTAGCATGGCCCCTGCACAAGGATGACAC was obtained. BLAST was used to compare the highly homologous sequence with the whole genome sequence of Rhodosporidium YM25235, and two sequences were obtained and successfully located. to the U6 boot sequence TATA box (see figure 1 ), take the sequence about 2...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com