Supercharge Your Innovation With Domain-Expert AI Agents!

Application of hsa_circ_0006470 as target in preparation of miR-27b-3p regulator

A technology of mir-27b-3p and modulators, applied in biochemical equipment and methods, microbe determination/testing, DNA/RNA fragments, etc., can solve problems such as the pathogenic mechanism of gastric cancer that has not been fully elucidated

Pending Publication Date: 2022-01-11
东莞市松山湖中心医院
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Targeted therapy is considered to be the most promising alternative treatment for gastric cancer, but its clinical application still faces many difficulties. Current researchers have not fully elucidated the pathogenic mechanism of gastric cancer, and many unknown target sites and Signal pathways need to be discovered urgently

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of hsa_circ_0006470 as target in preparation of miR-27b-3p regulator
  • Application of hsa_circ_0006470 as target in preparation of miR-27b-3p regulator
  • Application of hsa_circ_0006470 as target in preparation of miR-27b-3p regulator

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Example 1 The interaction of HSA_CIRC_0006470 and MIR-27B-3P is demonstrated by a lucifener report.

[0050] First of all, the wild-type sequence of the synthetic gene of hsa_circ_0006470 (the WT, synthetic primers hsa_circ_0006470.F: ACTCATCATGGACTCCCTGC, hsa_circ_0006470.R: TGAGCACCTCCTTAGCAGACA) and mutant gene sequence (the MUT, synthetic primers hsa_circ_006470X.F: GGGACCGCATCTTCTTTGT, hsa_circ_006470X.R: GTGCTGCTCAAACTTGGTCTT), the Its 3`UTR ends are connected to the report of the Pmilglo vector, respectively, and construct fluorescene enzyme particles (Pmirglo-Circ_006470 WT Vectors or Pmirglo-Circ_006470 MUT VECTORS). The RNA sequence of MIR-27B-3PMIMICS (5'-UuCacaguaAguucugc-3 ') and control group (NC: 5'-uuuguacuacaaaaaguacug-3') was then synthesized by Genepharma Company. Double luciferase reporting experiments were performed using gastric cancer cells (AGS), divided into four groups in Table 2, and experimental data see figure 1 .

[0051] according to figure 1 ...

Embodiment 2

[0054] Example 2HSA_CIRC_0006470 RNAi Experiment

[0055] SiRNAs of HSA_CIRC_0006470, divided into two groups in two groups, one of the groups of SiRNAs transfected into HSA_CIRC_0006470 as a silent group (Si-SIRC-RNA), and another group was transfected using the same transfection. However, SiRNAs did not be added as a control group (Control).

[0056] The expression quantity of HSA_CIRC_0006470 and MIR-27B-3P in the two groups was detected by RT-PCR experiments. figure 2 .

[0057] The expression quantity of the target gene ROR1 in the two groups was detected by RT-PCR experiment, and the experimental data was found. image 3 .

[0058] according to Figure 2-3 The data can be seen that the expression of HSA_CIRC_0006470 in the silence group of the siRNAs transfected with HSA_CIRC_0006470 is significantly reduced relative to the control group, indicating that the silent group succeeds in the HSA_CIRC_0006470. The expression of MiR-27B-3P in the silence group of SiRNAs of HSA_CIRC_0...

Embodiment 3

[0069] Example 3 Effect of Over Expression PIK3CA on the AGS cells of HSA_CIRC_0006470 silencers

[0070] Over-expression plasmids of PIK3ca were synthesized, and the sik3ca and HSA_CIRC_0006470 were transfected into AGS cells in accordance with the same host and transfection conditions in the silencing group and the control group, and the PIK3CA overexpression group (Si-CircRNA + PIK3CA) was obtained.

[0071] The expression level of HSA_CIRC_0006470, PIK3CA and MIR-27B-3P, PIK3CA, and MIR-27B-3P after transfection was detected by RT-PCR experiment, and the experimental data see Figure 10 .

[0072] The expression level of PIK3CA, the PIK3CA, the Pik3ca of the Silent Group, the PIK3CA overdrawn group and the control group was detected by immunofluorescence experiment, and the experimental data see Figure 11 .

[0073] according to Figure 10 and Figure 11 The results were found that the expression of PIK3CA of the PIK3CA over-expression group was significantly up-regulated after t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an application of hsa_circ_0006470 as a target in preparation of a miR-27b-3p regulator, and other applications of the hsa_circ_0006470. The inventor finds that miR-27b-3p and the hsa_circ_0006470 have interaction through a dual luciferase report experiment, and finds that the expression of the miR-27b-3p can be improved by silencing the hsa_circ_0006470 through an RNAi (Ribonucleic Acid Interference) experiment, so that a downstream pathway of the miR-27b-3p, such as ROR1 (Restricted Osteogen Receptor 1), can be further influenced to further inhibit the proliferation and migration capabilities of gastric cancer cells, and in addition, the expression of PIK3CA can be inhibited to promote an autophagy effect; and the PIK3CA is overexpressed in the cancer cells with the silent hsa_circ_0006470, so that the phenotype caused by the silent hsa_circ_0006470 can be relieved. The results show that the hsa_circ_0006470 has a close relationship with the miR-27b-3p, the PIK3CA, the proliferation and migration of the gastric cancer cells, the autophagy effect of the cells and the like, therefore, the application of the hsa_circ_0006470 serving as the target in preparation of the miR-27b-3p regulator, a PIK3CA regulator, autophagy and autophagy-related disease drugs and cancer treatment drugs and the application of the hsa_circ_0006470 serving as a molecular marker in preparation of cancer diagnostic reagents have huge potential values.

Description

Technical field [0001] The present invention relates to the field of biomedicine, in particular, to use as targets in the preparation hsa_circ_0006470 miR-27b-3p conditioning agent, hsa_circ_0006470 use as targets in the preparation of PIK3CA adjusting agent, a target preparation hsa_circ_0006470 in autophagy and since medicament autophagy-related diseases. Hsa_circ_0006470 as a target application in the treatment of cancer medicament. hsa_circ_0006470 use as a biomarker in the diagnosis of cancer in the reagent preparation. Background technique [0002] Autophagy is the degradation and energy cycle pathways mediated cell lysosomes, autophagic errors or unwanted intracellular proteins and other macromolecules can be wrapped, and then forming autophagolysosome thereby lysosomes wrapped macromolecules degradation. Autophagy is an evolutionary process to protect cells, which are involved in many processes of cell growth and development, autophagy abnormalities can cause abnormal cel...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886A61K45/00A61P35/00C12N15/113
CPCC12Q1/6886A61K45/00A61P35/00C12Q2600/158C12Q2600/178Y02A50/30
Inventor 崔业佳蒲荣叶锦俊黄浩海廖丹陈婉婵
Owner 东莞市松山湖中心医院
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More