Kit for detecting gene methylation of cervical cells based on fluorescent quantitative PCR technology and application of kit
A methylation and fluorescent reporter group technology is applied in the field of nucleic acid combinations and kits for detecting cervical cell gene methylation, and achieves the effects of rapid and objective detection results, high sensitivity and cost savings
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Embodiment 1 detection kit and using method thereof
[0037] The kit includes the following components:
[0038] PCR reaction solution, enzyme mixture, detection reaction solution, positive control, negative control;
[0039]The PCR reaction solution includes 10× buffer, 25mM MgCl2, 10mM dUTP and 10mM dNTPs; the enzyme mixture includes Taq enzyme and UNG enzyme, and detects cervical cancer methylation genes SOX1, PAX1, MSC upstream and downstream primers, and probes in the reaction solution. The needle ratio is: 4:4:1; the upstream primer is 400nM, the downstream primer is 400nM, and the probe is 100nM.
[0040] See Table 1 for the nucleotide sequences of the primers and probes of the cervical cancer methylation gene SOX1 or PAX1 or MSC used in this example.
[0041] Table 1 Nucleotide sequence list of primers and probes of cervical cancer methylation gene SOX1 or PAX1 or MSC in the present invention
[0042] SOX1-F ATAAACTACCCGCTACCTACCCG SEQ ID No.1...
Embodiment 2
[0071] Embodiment 2: test kit detection accuracy
[0072] The 308 clinical samples that have been detected so far are compared with the gold standard method of cervical cancer-colposcopy combined with pathological detection results. There are 50 normal samples of pathological diagnosis, 47 cases of cervical invasive cancer samples, and 55 cases of carcinoma in situ CIS samples. , there are 115 cases of CIN3 stage samples, and 41 cases of CIN2 and below samples; the implementation method provided in Example 1 is used for detection. The comparison results of different stages can be seen in Table 6.
[0073] Table 6 Comparison of detection results of cervical cancer and precancerous lesions at different stages by multi-gene combined detection technology for cervical cancer
[0074]
[0075] Cervical exfoliated cell methylation gene (SOX1, PAX1, MSC) DNA detection result shows that the detection sensitivity of the test kit that embodiment 1 provides is respectively 97.39% and ...
Embodiment 3
[0076] Example 3: ROC Curve of Precancerous Lesions and Cervical Cancer
[0077] This experimental example provides the ROC curve for the detection of precancerous lesions and cervical cancer by the multi-target detection technology of exfoliated cell DNA.
[0078] In this experimental example, precancerous lesions and cervical cancer are detected experimentally by using the kit and experimental method provided in Example 1.
[0079] Tutu Institute figure 2 As shown, cervical exfoliated cell DNA multigene detection technology can clearly distinguish cervical precancerous lesions and cervical cancer from normal controls, and the area of the ROC curve (AUC) for detecting CIN3 and CIS is 0.966 (0.95-0.98, 95%CI ; P<0.0001).
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com